Information

Excretion and metabolic waste?

Excretion and metabolic waste?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I know there is a difference between digestive and metabolic waste, but which one is called excretion? And what's the other one called? Thanks!


Egestion is the expulsion of undigested food which occurs typically via the anus. Although, interestingly or maybe just gross, flatworms must use their mouth has they have no anus. This is the non-metabolised material.

Excretion is the transfer of any metabolised material to the environment, including urine or carbon dioxide.


13) Excretion in humans

Excretion is the removal of the following substances:

  • toxic materials
  • waste products of metabolism
  • excess substances from organisms

Excess amino acids are deaminated in the liver to form glycogen and urea. The urea is removed from the tissues by the blood and expelled by the kidneys.

  • Liver – Breaks down excess amino acids and produces urea.
  • Lungs – Get rid of CO2 and H2O when breathing out.
  • Kidneys – Removes urea and other nitrogenous waste from the blood, and expel excess water, salts. Hormones and drugs.
  • Skin – Loses water, salt, urea but not an excretory organ.

The liver and its role in producing proteins:

  • Plays an important role in assimilation (absorbing) amino acids.
  • Removes amino acids from the plasma of the bloodstream and builds them up into proteins.
  • Proteins are long chains of amino acids, joined together by peptide bonds.

Deamination: is the removal of the nitrogen-containing part of amino acids to form urea.

  • Urine is taken from the kidneys to the bladder by the ureters.
  • Urethra is the tube that carries urine out of the body.
  • Some of the compounds made in reactions in the body are potentially toxic if their concentrations build up.
  • CO2 dissolves in fluids such as tissue fluid and blood plasma to form carbonic acid. This increase in acidity can affect the actions of enzymes and can be fatal.
  • Ammonia is made in the liver when excess amino acid are broken down. However, ammonia is very alkaline and toxic. It is converted to urea which is much less poisonous, making it a safe way of excreting excess nitrogen.

Microscopic structure of the kidneys:

  • The kidney tissue consists of many capillaries and tiny tubes, called renal tubules, held together with connective tissue.
  • The cortex is the dark, outer region.
  • The medulla is the lighter, inner zone.
  • A renal artery carries blood to the kidney and a renal vein carries it away.
  • The ureter carries urine from the kidney to the bladder.
  • Where the ureter joins the kidney there is a space called the pelvis.
  • The renal artery divides up into a great many arterioles and capillaries, mostly in the cortex.
  • Each arteriole leads to a glomerulus. This is a capillary repeatedly divided and coiled, making a knot of vessels.
  • Each glomerulus is almost entirely surrounded by a cup-shaped organ called a renal capsule, which leads to a coiled renal tubule.
  • This tubule, after a series of coils and loops, joins a collecting duct, which passes through the medulla to open into the pelvis.
  • A nephron is a single glomerulus with its renal capsule, renal tubule and blood capillaries.
  • The blood pressure in a glomerulus causes part of the blood plasma to leak through the capillary walls.
  • The red blood cells and the plasma proteins are too big to pass out of the capillary, so the fluid that does filter through is plasma without the protein.
  • The fluid thus consists mainly of water with dissolved salts, glucose, urea and uric acid.
  • The process by which the fluid is filtered out of the body by the glomerulus is called ultrafiltration.
  • The filtrate from the glomerulus collects in the renal capsule and trickles down the renal tubule.
  • As it does so, the capillaries that surround the tubule absorb back into the blood these substances which the body needs.
  • First, all the glucose is reabsorbed, with much of the water.
  • Then some of the salts are taken back to keep the correct concentration in the blood.
  • The process of absorbing back the substances needed by the body is called selective reabsorption.
  • The molecules which are not selectively reabsorbed continue along the nephron tubule as urine .

The dialysis machine (artificial kidney):

Dialysis is a treatment that filters and purifies the blood using a machine

  • a glucose concentration similar to a normal level in the blood
  • a concentration of ions similar to that found in normal blood plasma
  • no urea

As the dialysis fluid has no urea in it, there is a large concentration gradient – meaning that urea moves across the partially permeable membrane, from the blood to the dialysis fluid, by diffusion.

As the dialysis fluid contains a glucose concentration equal to a normal blood sugar level, this prevents the net movement of glucose across the membrane as no concentration gradient exists.

As the dialysis fluid contains an ion concentration similar to the ideal blood plasma concentration, movement of ions across the membrane only occurs where there is an imbalance.


ROLE OF THE KIDNEYS | Histology of the Kidney

Introduction

Excretion involves the separation and elimination of metabolic waste products from the body. Various organs are involved in this process: the lungs, gills, skin, etc. The kidneys and their ducts are the major full-time excretory organs and comprise the excretory system.

In addition to the elimination of metabolic wastes, the excretory system functions in the maintenance of a proper water balance in the body: an equilibrium of water, inorganic salts, and other substances in the internal environment of the organism. There is a great difference in the problems of water balance encountered by marine, freshwater, and terrestrial vertebrates, and it is remarkable that their kidneys are as much alike as they are.

The kidney of all vertebrates consists of knots of blood vessels, either glomeruli or glomera, closely associated with masses of kidney tubules ( Figures 1(a), 1(b), and 2 ). A single tubule, with its associated blood vessels, is a nephron.

Figure 1 . Photomicrographs of a section of the kidney of a spiny dogfish (Squalus acanthias). (a) Three glomeruli (singular, glomerulus) at the right are surrounded by masses of renal tubules. Delicate capillaries (not seen) invade the loose connective tissue between the tubules. 10 ×. (b) One of the glomeruli from (a) is surrounded by a nephric capsule (Bowman’s capsule). The capsule consists of a simple squamous epithelium and resembles a balloon which has been pushed in by the glomerulus so that each capillary is covered by the visceral layer of the nephric capsule and the space is enclosed by the parietal layer. Masses of renal tubules fill the remaining field. Occasional capillaries appear between the tubules 40 ×.

Figure 2 . Micrographs to demonstrate the capillary loops in renal corpuscles of a freshwater teleost fish (Carassius auratus gibelio) Top: Photomicrograph of a section showing the well-developed knot of capillaries with many loops and widely patent lumina. AA, afferent arteriole with juxtaglomerular cells (arrows). Scale = 10 μm. Bottom: Scanning electron micrograph of the surface of the capillary loops sporting globular podocytes from which extend primary and secondary foot processes. Scale = 10 μm.

From Elger M and Hentschel H (1981) The glomerulus of a stentohaline fresh-water teleost, Carassius auratus gibelio, adapted to saline water. A scanning and transmission electron-microscopic study. Cell and Tissue Research 220: 73–85 .


Excretion and metabolic waste? - Biology

Audesirk / Audesirk: Life on Earth Chapter 21: Nutrition, Digestion and Excretion

What Nutrients do Animals Need?

A. Animal nutrients fall into five major classes: carbohydrates, lipids, proteins, minerals, vitamins.

1. These nutrients provide the body with its basic needs: a. energy to fuel cellular metabolism and activities

b. the chemical building blocks, such as amino acids, to construct complex molecules unique to each organism

c. minerals and vitamins that participate in a variety of metabolic reactions.

1. Complex carbohydrates are the main source of energy taken into the body. Animals, including humans, store a carbohydrate called glycogen (a highly branched chain of glucose molecules) in the liver and muscles. This is subsequently degraded to glucose, the main source of energy available to individual cells.

2. Simple sugars do not have fiber or vitamins and minerals.

1. Phospholipids and cholesterol are important components of membranes fats are energy reserves and provide insulation and cushioning.

2. Fats make up 40 percent of the American diet, they should be less than 30 percent.

3. The body needs very little polyunsaturated fat to supply the essential fatty acids, those not made by the body itself. Humans are unable to synthesize linoleic acid, which is required for the synthesis of certain phospholipids, so we need to obtain this essential fatty acid.

4. Cholesterol is used in the synthesis of bile acids and sex hormones, but too much causes damage to the circulatory system.

1. The breakdown of protein produces the waste product urea which is filtered from the blood by the kidneys. Specialized diets in which protein is the major energy source place extra stress on the kidneys. The major role of dietary protein is a source of amino acids to make new molecules.

2. Of the twenty different amino acids in proteins, nine are essential. That is, must be supplied by the diet in foods such as meat, milk, eggs, corn, beans, and soybeans. Because many plant proteins are deficient in some of the essential amino acids, individuals on a vegetarian diet must include a variety of plants whose proteins together will provide all none, or they will risk protein deficiency.

1. Animals require a wide variety of minerals which are small inorganic molecules and elements

2. Minerals must be obtained through the diet, either from food or dissolved in the water.

3. Required minerals include:

a. Ca, Mg, P (bones and teeth)

b. Na, K (muscle contraction and conduction of nerve impulses)

c. Fe (production of hemoglobin)

d. I (found in hormones produced by the thyroid gland)

e. trace amounts of zinc, copper and selenium are also required.

1. Humans need small amounts of at least thirteen organic molecules called vitamins to assist in cellular metabolism.

2. Vitamins cannot be synthesized by the body (in adequate amounts) and must be obtained from food.

3. Human vitamins are grouped in two categories: water soluble and fat soluble.

4. Water soluble vitamins include vitamin C and eleven different compounds that make up the vitamin B complex which dissolve in the blood and are excreted by the kidneys. These vitamins generally work in conjunction with enzymes to promote chemical reactions that supply energy or synthesize materials.

5. The fat soluble vitamins A, D, E, and K can be stored in body fat and may accumulate in the body over time. In particular, vitamin K helps regulate blood clotting and vitamin A is used to produce visual pigment for the eye. Fat soluble vitamins may be toxic if consumed in excessively high doses.

A. Early humans ate fruits and vegetables today's humans eat foods loaded with fats, sugar, and salt.

B. The recommended proportions in the human diet are:

1. Complex carbohydrates: 58-60%

2. Proteins: 12-15%

3. Fats and other lipids: 20-25%

C. A balanced diet will normally meet all requirements for these substances excessive intake is at least wasteful, and at worst harmful.

A. The energy in nutrients is measured in calories. A calorie is the amount of energy required to raise the temperature of 1 gram of water by 1 degree Celsius. The calorie content of foods is measured in units of Calories (1000 calories).

B. To maintain acceptable weight, caloric intake must balance energy output. The human body at rest burns 1550 Calories per day. Exercise significantly boosts caloric requirements.

C. Caloric requirements can be estimated by multiplying your desired weight by 10 (inactive person), or 15 (moderately active), or 20 (very active) and then subtracting from 0 to 400 depending on age.

Age 25-34 subtract zero.

Age 35-44 subtract 100

Age 45-54 subtract 200.

Age 55-64 subtract 300.

Over 65 subtract 400.

D. Obesity is an excess of fat in the body's adipose tissue by definition that term is applied to persons who are 25 percent heavier than ideal.

Nutrition and Organic Metabolism

A. Nutrient molecules are shuffled and reshuffled once they have been absorbed.

B. Shortly after a meal, the level of carbohydrates rises some are converted to fat for storage, and others are converted to glycogen in the liver and muscle tissue.

C. Between meals, glucose levels are maintained by breakdown of glycogen reserves in the liver and amino acids are converted to glucose fatty acids from fats can be used directly by cells for energy.

D. The liver is a valuable organ for conversion of nutrients and detoxification of chemicals.

1. The digestive system is an internal space or tube with specialized regions for food transport, processing, and storage. a. An incomplete digestive system has one opening.

b. A complete digestive system is a tube with two openings, allowing food to move in one direction through the lumen.

2. The digestive system performs these five functions:

a. Ingestion: the food must be brought into the digestive organ

b. Mechanical breakdown: the food must be physically broken down into pieces, mixed, and transported.

c. Chemical breakdown: the particles of food must be exposed to enzymes and hormones which cause large molecules to be broken down into smaller molecules capable of crossing the gut lining.

d. Absorption: the small molecules must be transported out of the digestive organ and into the blood and lymph.

e. Elimination is the expulsion of undigested and unabsorbed residues at the end of the gut.

1. Intracellular digestion: once engulfed by a cell, the food is enclosed in a food vacuole. The food vacuole later fuses with lysosomes and the food is broken down within the vacuole into smaller molecules which can be absorbed into the cell cytoplasm.

2. Extracellular digestion:

a. The gastrovascular cavity found in cnidarians, such as the sea anemone, hydra, and jellyfish is a form of extracellular digestion. Food captured by stinging tentacles is brought into the gastrovascular cavity where enzymes break it down. Cells lining the cavity absorb nutrients and engulf small food particles where further digestion occurs using intracellular digestion. The undigested remains are eventually expelled through the same opening by which they entered.

b. Digestion in a tube: humans and other vertebrates have tubular digestive tracts with several compartments which food is first physically, then chemically broken down before being absorbed by individual cells. Animals with tubular digestive tracts thus use extracellular digestion to break down their food.

3. Regional specialization’s correlate with feeding behavior.

a. Ruminants (for example, cows) may eat grass continuously and have multiple stomachs to digest cellulose.

b. Ruminant stomachs have four chambers. The first chamber, the rumen, has evolved into a massive fermentation vat including many species of bacteria and ciliates which thrive in a mutually beneficial relationship with the ruminant. These microorganisms produce cellulase, the enzyme which breaks cellulose into its component sugars.

c. Animals with discontinuous feeding habits may have organs for storage. i.e. squirrels

The Human Digestive System (Table 29-6)

Chapter 21 Section 3 / Lab Manual Chapter 17.1

A. The human digestive system is more than 20 feet long.

1. Specialized regions include the mouth, pharynx, esophagus, stomach, small intestine, colon, rectum, and anus.

2. Accessory glands include the salivary glands, liver (with gallbladder), and pancreas.

The Urinary System and Homeostasis

A. The volume and composition of extracellular fluid, which consists of interstitial fluid surrounding living cells and blood in the vessels, is kept within tolerable ranges by the urinary system.

B. The mammalian urinary system helps maintain homeostasis in several ways:

1. It regulates the blood levels of ions such as sodium, potassium, chloride and calcium.

2. It regulates the water content of the blood

3. It maintains the proper pH of the blood.

4. Retention of important nutrients such as glucose and amino acids in the blood.

5. It secretes hormones such as erythropoietin which stimulates red blood cell production

6. It eliminates cellular waste products such as urea.

1. Water is gained by two processes: a. Absorption of water from liquids and solid foods occurs in the gastrointestinal tract.

b. Metabolism of nutrients yields water as a by-product.

2. Water is lost by at least four processes:

a. Excretion of water is accomplished by urinary excretion.

b. Evaporation occurs from respiratory surfaces and through the skin.

c. Sweating occurs on the skin surface.

d. Elimination of water in feces is a normal occurrence.

D. Solute Gains and Losses

1. Solutes are added to the internal environment by four processes: a. Nutrients, mineral ions, drugs, and food additives are absorbed by the gastrointestinal tract.

b. Secretion from endocrine glands adds hormones.

c. Respiration puts oxygen into the blood.

d. Metabolism reactions contribute waste products.

2. Mineral ions and metabolic wastes are lost in these three ways:

a. Urinary excretion disposes of ammonia (formed from amino acids), urea (formed in the liver by joining two ammonia’s), and uric acid (from nucleic acids).

b. Respiration disposes of carbon dioxide, the most abundant metabolic waste.

c. Sweating results in the loss of mineral ions.

Urinary System of Mammals

1. Kidneys (2) filter a variety of substances from the blood.

a. Most of the filtrate is returned to the blood about 1 percent ends up as urine.

b. The kidneys regulate the volume and solute concentrations of extracellular fluid.

2. Urine flows from each kidney through a ureter to a urinary bladder (for storage) and then out of the body through the urethra.

3. Urination is a reflex response but can be controlled by nervous and muscular actions.

Kidney Structure and Function

A. Each kidney is a bean-shaped structure about the size of a fist.

1. A tough coat of connective tissue, the renal capsule, covers each kidney.

2. Inside there is an outer cortex region overlying a medulla region.

3. Nephrons consisting of blood capillaries and tubules filter water and solutes from the blood and return much of it.

B. Functional Units of the Kidney The Nephrons

1. Filtration occurs in the glomerulus, a ball of capillaries nestled in the Bowman's capsule.

2. The Bowman's capsule collects the filtrate and directs it through the continuous nephron tubules: proximal -> loop of Henle -> distal -> collecting duct.

3. The capillaries exit the glomerulus, converge, then branch again into the peritubular capillaries around the nephron tubules, where they participate in reclaiming water and essential solutes.

Urine-Forming Processes, An Overview

1. In filtration, blood pressure forces filtrate out of the glomerular capillaries into Bowman's capsule, then into the proximal tubule.

a. Blood cells, proteins, and other large solutes cannot pass the capillary wall into the capsule.

b. Water, glucose, sodium, and urea are forced out.

2. Reabsorption takes place in the tubular parts of the nephron, where water and solutes move across the tubular wall, out of the nephron, and into the surrounding capillaries.

3. Secretion moves substances from the capillaries into the nephron walls.

a. Capillaries surrounding the nephrons secrete excess amounts of hydrogen ions and potassium ions into the nephron tubules.

b. This process also rids the body of drugs, uric acid, hemoglobin breakdown products, and other wastes.

4. Urine can become concentrated because there is an osmotic concentration gradient of salts and urea in the interstitial fluid surrounding the loop of Henle.

A. Factors Influencing Filtration

1. The kidneys can process about 125 ml (about 4 oz) of blood each minute because of two factors: a. Glomerular capillaries are highly permeable to water and small solutes.

b. Blood enters the glomerulus under high pressure, these arterioles have wider diameters than most arterioles do.

2. The rate at which the kidneys filter a given volume of blood depends on the flow of blood through them and the rate of reabsorption in the tubules neural and hormonal controls operate.

B. Reabsorption of Water and Sodium

1. Mechanisms within the kidney carefully regulate the excretion and retention of substances based on intake and bodily need. a. Sodium ions are pumped out of the proximal tubule (filtrate) and into the interstitial fluid surrounding the peritubular capillaries.

b. Significant amounts of water flow passively down the gradient that has been created.

c. In the descending limb of the loop of Henle, water moves out by osmosis, but in the ascending portion sodium is pumped.

d. This interaction of the limbs of the loop produces a very high solute concentration in the deeper parts of the kidney medulla and delivers a rather dilute urine to the distal tubule.

2. Hormone-Induced Adjustments

a. Antidiuretic hormone (ADH) from the posterior pituitary is secreted in response to a decrease in extracellular fluid ADH causes the distal tubules and collecting ducts to become permeable to water, which moves back into the blood capillaries thereby allowing more water to be reabsorbed from the urine.

b. When sodium levels fall so does the volume of extracellular fluid this triggers certain kidney cells to secrete renin, which acts on the adrenal cortex to release aldosterone, which promotes sodium reabsorption.

c. When solute concentration in the extracellular fluid rises, the thirst center of the hypothalamus responds by decreasing saliva production, causing thirst.

C. Regulation of blood pressure and oxygen content

1. Two hormones produced by the kidneys are important in regulating blood pressure and the blood oxygen carrying capacity renin and erythropoietin.

2. When blood pressure falls, the kidneys release renin into the bloodstream. Renin acts as an enzyme catalyzing the formation of a second hormone angiotensin. Angiotensin in turn causes arterioles to constrict elevating blood pressure.

3. Constriction of the arterioles carrying blood to the kidneys also reduces the rate of blood filtration causing less water to be removed from the blood. Water retention causes an increase in blood volume and hence an increase in blood pressure.

4. In response to low blood oxygen levels, the kidneys release a second hormone erythropoietin. Erythropoietin travels in the blood to the bone marrow where it stimulates more rapid production of red blood cells whose role is to transport oxygen.

A. Retention of excess sodium and water can lead to hypertension.

B. Deposits of uric acid, calcium salts, and other wastes can settle out in the renal pelvis to form kidney stones. Ouch.

C. Kidney dialysis machines are needed if normal controls over volume and composition of extracellular fluid are lost.

1. In hemodialysis, the machine is connected directly to a blood vessel for a four-hour treatment, three times a week.

2. In peritoneal dialysis, fluid is placed into the patient's abdominal cavity to serve as a medium for membrane dialysis, then drained after a length of time.

Maintaining the Body's Core Temperature

A. Many different physiological and behavioral responses help to maintain the body's internal core temperature.

B. Temperatures Suitable for Life

1. Enzymes remain functional within the 0 to 40 o C range.

2. Above 41 o C denaturation occurs, rendering the enzyme ineffective.

3. Cooler temperatures may not disrupt activity, but slow it by half for every 10 degree drop.

1. Radiation is the gain of heat from some source, or the loss of heat from the body to the surroundings depending on the temperatures of the environment.

2. Conduction is the transfer of heat from one object to another when they are in direct contact, as when a human sits on cold (or hot!) concrete.

3. Convection is the transfer of heat by way of a moving fluid such as air or water.

4. Evaporation is a process whereby a heated substance changes from a liquid to a gaseous state, with a loss of heat to the surroundings.

Classification of Animals Based on Temperature

1. Animals with low metabolic rates gain their heat from the environment.

2. Ectotherms, such as lizards, make adjustments to changing external temperatures in what we call behavioral temperature regulation.

1. Endotherms generate heat from metabolic activity and also exercise controls over heat conservation and dissipation.

2. Endotherms have adaptations such as feathers, fur, or fat to reduce heat loss they also adjust their behavior by moving underground during the heat of the day, for instance.

C. Heterotherms, such as the hummingbird, generate body heat during their active periods but resemble ectotherms during inactive times.

D. Thermal Strategies Compared

1. Ectotherms are at an advantage in the tropics where they do not have to expend much energy to maintain body temperature.

2. Endotherms have an advantage in moderate to cold settings.

Temperature Regulation in Mammals

A. Responses to Cold Stress

1. Mammals respond to cold by constricting the smooth muscles in the blood vessels of the skin (peripheral vasoconstriction), which retards heat loss.

2. In the pilomotor response, the hairs or feathers become more erect to create a layer of still air that reduces convective and radiative heat losses.

3. Rhythmic tremors (shivering) is a common response to cold but is not effective for very long and comes at high metabolic cost.

4. Hibernating mammals can produce nonshivering heat by a hormonal stimulation of a special brown adipose tissue.

5. Hypothermia is a condition in which the core temperature drops below normal it may lead to brain damage and death frostbite is localized cell death due to freezing.

B. Responses to Heat Stress

1. Peripheral vasodilation is the enlargement of the diameters of blood vessels to allow greater volumes of blood to reach the skin and dissipate the heat.

2. Evaporative heat loss by sweating is a common and obvious cooling mechanism.

3. Panting is used by animals with very little ability to sweat.

4. Hyperthermia is a rise in core temperature, with devastating effects.

1. During a fever, the hypothalamus resets the body's "thermostat" to a new temporary core temperature. a. At the onset of fever, heat loss decreases and heat production increases the person feels chilled.

b. When the fever breaks, peripheral vasodilation and sweating increase as the body attempts to reduce the core temperature to normal.

2. The controlled increase in body temperature (within limits) during a fever seems to enhance the body's immune response.

Copyright 2000 by Steven Wormsley
Last Updated on January 5, 2000 by Steven Wormsley


Flame Cells of Planaria and Nephridia of Worms

As multi-cellular systems evolved to have organ systems that divided the metabolic needs of the body, individual organs evolved to perform the excretory function. Planaria are flatworms that live in fresh water. Their excretory system consists of two tubules connected to a highly branched duct system. The cells in the tubules are called flame cells (or protonephridia ) because they have a cluster of cilia that looks like a flickering flame when viewed under the microscope, as illustrated in Figure 22.10 a . The cilia propel waste matter down the tubules and out of the body through excretory pores that open on the body surface cilia also draw water from the interstitial fluid, allowing for filtration. Any valuable metabolites are recovered by reabsorption. Flame cells are found in flatworms, including parasitic tapeworms and free-living planaria. They also maintain the organism’s osmotic balance.

Figure 22.10. In the excretory system of the (a) planaria, cilia of flame cells propel waste through a tubule formed by a tube cell. Tubules are connected into branched structures that lead to pores located all along the sides of the body. The filtrate is secreted through these pores. In (b) annelids such as earthworms, nephridia filter fluid from the coelom, or body cavity. Beating cilia at the opening of the nephridium draw water from the coelom into a tubule. As the filtrate passes down the tubules, nutrients and other solutes are reabsorbed by capillaries. Filtered fluid containing nitrogenous and other wastes is stored in a bladder and then secreted through a pore in the side of the body.

Earthworms (annelids) have slightly more evolved excretory structures called nephridia , illustrated in Figure 22.10 b . A pair of nephridia is present on each segment of the earthworm. They are similar to flame cells in that they have a tubule with cilia. Excretion occurs through a pore called the nephridiopore . They are more evolved than the flame cells in that they have a system for tubular reabsorption by a capillary network before excretion.


Discussion

Our goal was to characterize the major metabolic adjustments of a hibernator during prolonged fasting under normothermic conditions, and to assess possible seasonal effects. This study shows that woodchucks use a dual strategy to cope with normothermic fasting: (1) they rapidly depress their metabolic rate (unless they already function at very low rates as in the spring), possibly reducing energy expenditure to the lowest level still compatible with normothermic life, and (2) they reorganize their fuel selection pattern to spare limited reserves of proteins.

Fasting-induced metabolic depression

In the fed state, metabolic rate is much higher in the summer than in the spring (+35% see Table 1), and this observation is consistent with published measurements on post-absorptive woodchucks and marmots (Bailey,1965 Körtner and Heldmaier, 1995 Rawson et al., 1998). After spring arousal, a low basal metabolic rate appears critical for surviving the normothermic fasting period that typically follows 5 months of hibernation (Davis,1967 Hamilton,1934 Snyder et al.,1961). During fasting, metabolic depression was only used in the summer (25% reduction in O2 over 2 weeks Fig. 2), and it did not occur in the spring. This observation suggests the interesting possibility that normothermic, basal metabolism has a lower limit. The potential existence of a minimum basal metabolic rate for normothermic mammals is supported by the fact that summer and spring woodchucks reach the same rate of energy expenditure after 14 days of fasting, even though their pre-fasting rates are very different. Measurements on rabbits provide additional support for the same concept because this species starts with a much higher post-absorptive metabolic rate than spring or summer woodchucks, but it shows stronger metabolic depression during fasting (-32% in only 7 days). The rapid decrease in energy expenditure shown by rabbits is insufficient to completely offset their high post-absorptive metabolic rate(Table 1, Fig. 2A), and, therefore, loss of body mass is much more rapid in rabbits (-15% in 7 days) than in woodchucks(-13% in 14 days) (Fig. 1). For this reason, the rabbit experiments had to be terminated after 1 week(according to the limit set by our animal care committee), and we could not determine whether a longer period of fasting would eventually decrease the metabolic rate of rabbits to the lower levels observed in woodchucks. In both species, metabolic depression was accompanied by a small, but significant decrease in body temperature (Fig. 3), as previously observed in other species including the rat(Ma and Foster, 1986). Like spring woodchucks, other mammals with naturally low basal metabolic rates seem to lack the capacity for metabolic depression during fasting. Experiments on the Virginia opossum Didelphis virginiana, a marsupial of similar body size (3-4 kg), revealed that this nocturnal species reaches its lowest metabolic rate of ∼200 μmol O2 kg -1 min -1 (or 4.5 ml O2 kg -1 min -1 )during daylight sleep (see fig. 1 in Weber and O'Connor, 2000). This minimum post-absorptive rate is identical to the lowest value observed here in woodchucks(Fig. 2A) and the Virginia opossum is not able to decrease its metabolic rate further in response to fasting (Weber and O'Connor,2000).

The two main ATP-consuming processes accounting for basal metabolic rate are trans-membrane ion pumping and protein synthesis(Rolfe and Brown, 1997). It is conceivable that mammals can only downregulate these essential processes to a minimal level, below which normothermic life is compromised. For example,decreasing the cost of ion pumping can be achieved by lowering ion leakiness of membranes through changes in the degree of saturation of phospholipids(Hulbert and Else, 2000). However, modifying phospholipid saturation will also affect many other important membrane functions through changes in overall fluidity (e.g. insulin sensitivity), and such widespread disruption may not be compatible with mammalian life at ∼37°C. Another way to decrease energy expenditure during fasting would be to lower mitochondrial proton leak, a process that uncouples oxygen consumption from ADP phosphorylation. Two recent studies show that fasting and calorie restriction do not affect proton leak(Bézaire et al., 2001 Ramsay et al., 2004), whereas another suggests that proton leak is decreased via complex mechanisms that vary with the duration of calorie restriction(Bevilacqua et al., 2004). Clearly, the potential existence of a minimum normothermic metabolic rate in endotherms, and the mechanistic limitations for its specific set point,warrant further investigation.

Changes in fuel selection: protein sparing

In addition to metabolic depression, prolonged fasting has important effects on fuel selection. In our experiments, the major changes elicited by food deprivation took place within 2 days, and, therefore, all the values measured after this time were pooled for each group of animals(Fig. 4). In both species, the dominant use of carbohydrates that normally support energy metabolism in the post-absorptive state (phase I) was rapidly replaced by high lipid use (phase II) as fasting was continued (Fig. 4). However, the most striking differences in fuel selection were observed in relation to protein sparing. In the spring, woodchucks had the lowest rate of net protein oxidation, presumably because their fuel selection pattern reflected the hibernation state more closely than in the summer. In the fed state, proteins only accounted for 8% of metabolic rate in spring woodchucks, whereas it reached 17%O2 in summer woodchucks, and a high value of 28%O2 in rabbits(Fig. 4A). All groups had the ability to decrease absolute and relative rates of net protein oxidation in response to fasting. After more than 3 days without food, the contribution of proteins was reduced to 5%O2 in spring woodchucks, 6%O2 in summer woodchucks and 20%O2 in rabbits. Therefore, woodchucks show a superior ability for protein sparing (also reflected by much lower rates of water consumption and urine production than the rabbits see Fig. 6),particularly during the summer. At this time of year, they can not only decrease their overall rate of energy expenditure to cope with fasting, but also dramatically reduce their reliance on proteins. This metabolic strategy helps to conserve muscle mass and it has been observed in other species adapted for prolonged fasting. Breeding adult seals and post-weaning seal pups commonly cope for several weeks without food by reducing their metabolic rate to ∼45% of normal values in fed animals and their reliance on proteins down to 6% of O2(Nørdoy et al., 1993, 1990 Worthy and Lavigne, 1987). However, the most extreme capacity for protein sparing may be found in bears. During the summer, pack ice recession prevents polar bears U. maritimus from hunting seals and they appear to lower protein oxidation to 1% of O2 in response to fasting (Atkinson et al.,1996 Nelson,1987). Black bears Ursus americanus and grizzly bears U. arctos decrease body temperature by a few degrees and metabolic rate by ∼30% during their `pseudo-hibernation', which can last for up to 6 months (Watts et al., 1981). During this time, no nitrogen wastes are excreted(Barboza et al., 1997 Nelson, 1973, 1980 Nelson et al., 1973) and two possible mechanisms have been invoked to explain this observation: (1) a complete inhibition of protein oxidation and/or (2) the recycling of nitrogen waste products. More recent experiments where muscle biopsies have been sampled at the beginning and at the end of winter show that protein breakdown of hibernating bears is actually significant but low(Tinker et al., 1998). Therefore, they do have the ability to recycle nitrogen because no waste products are accumulated during hibernation.


Words to Know

Antidiuretic hormone: Chemical secreted by the pituitary gland that regulates the amount of water excreted by the kidneys.

Hemodialysis: Process of separating wastes from the blood by passage through a semipermeable membrane.

Nephron: Filtering unit of the kidney.

Urea: Chemical compound of carbon, hydrogen, nitrogen, and oxygen produced as waste by cells that break down protein.

Ureter: Tube that carries urine from a kidney to the urinary bladder.

Urethra: Duct leading from the urinary bladder to outside the body through which urine is eliminated.

The waste-containing fluid that remains in the nephrons is called urine. Urine is 95 percent water, in which the waste products are dissolved. A pair of tubes called ureters carry urine from the kidneys to the urinary bladder. Each ureter is about 16 to 18 inches (40 to 45 centimeters) long. The bladder is a hollow muscular sac located in the pelvis that is collapsed when empty, but pear-shaped and distended when full. The bladder in an adult can hold more than 2 cups (0.6 liters) of urine. The bladder empties urine into the urethra, a duct leading to outside the body. In males, the urethra is about 8 inches (20 centimeters) long. In females, it is less than 2 inches (5 centimeters) long. A sphincter muscle around the urethra at the base of the bladder controls the flow of urine between the two.

The volume of urine excreted is controlled by the antidiuretic hormone (ADH), which is released by the pituitary gland (a small gland lying at the base of the skull). If an individual perspires a lot or fails to drink enough water, special nerve cells in the hypothalamus (a region of the brain controlling body temperature, hunger, and thirst) detect the low water concentration in the blood. They then signal the pituitary gland to release ADH into the blood, where it travels to the kidneys. With ADH present, the kidneys reabsorb more water from the urine and return it to the blood. The volume of urine is thus reduced. On the other hand, if an individual takes in too much water, production of ADH decreases. The kidneys do not reabsorb as much water, and the volume of urine is increased. Alcohol inhibits ADH production and therefore increases the output of urine.


Methods

Medium and strains

All strains used in this study are listed in S1 Table. All yeast nomenclature follows the standard convention. For all experiments, frozen yeast strains stored at −80°C were first struck onto YPD plates (10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose + 2% agar) and grown at 30°C for approximately 48 hours, from which a single colony was inoculated into 3 mL of YPD and grown overnight at 30°C with agitation. All experiments were carried out within 5 days of generating the overnight culture. Minimal medium (SD) contained 6.7 g/L Difco Yeast Nitrogen Base without amino acids but with ammonium sulfate (Thermo Fisher Scientific, Waltham, MA, USA) and 20 g/L D-glucose, except during glucose-limitation experiments, in which lower levels of glucose were used as specified. Glucose starvation medium (S) comprised only 6.7 g/L Difco Yeast Nitrogen Base without amino acids but with ammonium sulfate. Nitrogen starvation medium (SD-N) contained 1.7 g/L Difco Yeast Nitrogen Base without amino acids or ammonium sulfate and 20 g/L D-glucose. Depending on strain auxotrophy, SD was supplemented with lysine (164.3 μM), adenine sulfate (108.6 μM) [74], or organosulfurs (134 μM) so that cells could grow exponentially.

Strains were constructed either via yeast crosses or by homologous recombination [74,75]. Crosses were carried out by mating parent strains, pulling diploids, sporulation, tetrad dissection, and selection on suitable plates. As an example of gene deletion, the bcy1Δ strain (WY2527) was constructed by PCR-amplifying the KanMX resistance gene from a plasmid (WSB26 [76]) using the primers WSO671 (TACAACAAGCAGATTATTTTCAAAAGACAACAGTAAGAATAAACGcagctgaagcttcgtacgc) and WSO672 (GAGAAAGGAAATTCATGTGGATTTAAGATCGCTTCCCCTTTTTACataggccactagtggatctg), with a 45-base pair homology (uppercase) to the upstream and downstream region of the BCY1 gene, respectively. The lys − strain WY2490 was then transformed with the PCR product, and transformants were selected on a G418 plate. Successful deletion was confirmed via a checking PCR with a primer upstream of the BCY1 gene (WSO673 TATACTGTGCTCGGATTCCG) paired with an internal primer for the amplified KanMX cassette (WSO161 ctaaatgtacgggcgacagt).

Evolution

Coculture evolution was described in an earlier study [32]. To revive a coculture, approximately 20 μL was scooped from the frozen sample using a sterile metal spatula, diluted approximately 10-fold into SD, and allowed to grow to moderate turbidity for 1–2 days. The coculture was further expanded by adding 3 mL of SD. Evolved lys − clones were isolated by plating the coculture on rich media (YPD) agar with hygromycin B.

For monoculture evolution, chemostat vessels (S14 Fig) were used (Methods, “Chemostats and turbidostats”). To create a sterile environment, initial assembly was done in autoclave trays, with vessels held in tube racks. Six reservoirs were prepared by adding 810 mL water to each bottle. Six vessels were prepared by adding a 10-mm stir bar and 20 mL growth media (SD + 21 μM lysine) to each vessel. Media delivery tubing was attached between reservoirs and vessels through rubber stoppers, and waste tubing was attached to each outflow arm, with the unattached end covered by foil held in place by autoclave tape. A 1.5-mL microcentrifuge tube was placed over the sampling needle and held in place by autoclave tape. Tubing ports were wrapped with foil as well. Each reservoir with its attached tubing was weighed, the entire assembly autoclaved, then each reservoir weighed again. Lost water was calculated and added back. Under sterile conditions, 90 mL of 10× SD and a lysine stock were added to each reservoir to reach a final lysine concentration of 21 μM. The vessels were then secured into the chemostat manifold receptacles, reservoirs placed on the scales, and tubing threaded into the pumps.

Ancestral or evolved lys − clones were grown in 50 mL SD + 164 μM lysine for approximately 20 hours prior to inoculation. Before each experiment, growth was tracked to ensure cells were growing optimally (approximately 1.6-hour doubling time). When cells reached a density of approximately 0.2 OD600, cells were washed 3 times in SD and inoculated in a chemostat vessel prefilled with SD + 21 μM lysine. After this step, chemostat pumps were turned on at a set doubling time in the custom-written LabView software package. Each chemostat vessel contained approximately 43 mL running volume and was set to a target doubling time (e.g., for 7-hour doubling, flow rate is 43 × ln2/7 = approximately 4.25 mL/h). We evolved 3 lines at 7-hour doubling and 3 lines at 11-hour doubling. With 21 μM lysine in the reservoir, the target steady-state cell density was 7 × 10 6 /mL. In reality, live-cell densities varied between 4 × 10 6 /ml and 1.2 × 10 7 /ml. Periodically, 4 mL of supernatant was harvested and dispensed into a sterile 15-mL conical tube. Next, 300 μL of this cell sample was removed and kept on ice for flow cytometry analysis. The remaining 3.7 mL of supernatant was filtered through a 0.22-μm nylon filter into 500-μL aliquots and frozen at −80°C. Each chemostat was sampled according to a preset sequence. For experiments with metabolite extraction, the chemostat vessel stopper was removed, and cells from 20 mL of sample were harvested (Methods, “Metabolite extraction)”. Because of the breaking of vessel sterility, this would mark the end of the chemostat experiment.

The nutrient reservoir was refilled when necessary by injecting media through a sterile 0.2-μm filter mounted on a 60 mL syringe. To take samples sterilely, the covering tube on the sampling needle was carefully lifted, and a sterile 5-mL syringe was attached to the needle. The needle was then wiped with 95% ethanol and slowly pushed down so that the tip was at least approximately 10 mm below the liquid level. A 5-mL sample was drawn into the syringe, the needle pulled up above the liquid surface, and an additional 1 mL of air drawn through to clear the needle of liquid residue. The syringe was then detached, and the cap was placed back on the needle. The samples were ejected into sterile 13-mm culture tubes for freezing and flow cytometry determination of live-cell densities. In both evolution experiments, samples were frozen in 1 part 20% trehalose in 50 mM sodium phosphate buffer (pH 6.0) + 1 part YPD. The samples were cooled at 4°C for 15 min before being frozen down at −80°C.

Whole-genome sequencing and data analysis are described in detail in [32].

Quantifying auxotroph frequency

Frozen cultures (2 time points from 3 monoculture evolution and 3 coculture evolution experiments) were revived, and clones were isolated and screened for auxotrophy. We revived frozen samples by directly plating samples on YPD (monoculture) or YPD + hygromycin (cocultures to select against the partner strain). Plates were grown at 30°C for approximately 2–4 days until all colonies were easily visible for picking. We observed a variety of colony sizes and screened both large and small sized colonies when both were present. We counted large and small colonies to estimate the ratio of large/small colony-forming cells in the population, then multiplied this fraction by the fraction of auxotrophs observed in each colony size class to get a full population auxotroph frequency estimate. To screen for auxotrophy, entire colonies were inoculated into 150 μL of SD, 10 μL of which was diluted into 150 μL SD in microtiter plates and incubated overnight to deplete organosulfur carryover or cellular organosulfur storage. In the case of some small colonies, no dilution was made as the inoculated cell density was already low enough, based on OD measurements. Then, 10–30 μL were diluted into a final volume of 150 μL each of SD + 164 μM lysine, SD + 164 μM lysine + 134 μM methionine, and YPD, aiming for OD of approximately 0.005–0.03 based off an initial reading by a 96-well plate OD600 reading of the starvation plate. Plates were then incubated for 48+ hours to grow cultures to saturation, and culture turbidity (OD600) was read using a 96-well plate reader. Control wells of known lysorgS − (WY1604) and lys − (WY2226) were included in the screening as controls. Wells that grew in SD + lysine + methionine and YPD but failed to grow in SD + lysine were scored as lysorgS − .

Fluorescence microscopy

Fluorescence microscopy experiments and data analysis are described in detail elsewhere [27]. Briefly, the microscope is connected to a cooled CCD camera for fluorescence and transmitted light imaging. The microscope harbors a temperature-controlled chamber set to 30°C. The microscope is equipped with motorized switchable filter cubes capable of detecting a variety of fluorophores. It also has motorized stages to allow z-autofocusing and systematic xy-scanning of locations in microplate wells. Image acquisition is done with an in-house LabVIEW program, incorporating autofocusing in bright field and automatic exposure adjustment during fluorescence imaging to avoid saturation. Previous analysis [27] has demonstrated that if fluorescence per cell is constant over time, then background-subtracted fluorescence intensity scales proportionally with live-cell density, and a decrease in fluorescence intensity correlates well with cell death.

For experiments in Fig 2 and S2 Fig, WY2490 (lys − ) and WY2527 (lysbcy1 − ) were grown overnight to exponential phase in SD + 164 μM lysine, washed 3 times in S medium, and starved for 3 hours at 30°C in factory-clean 13-mm test tubes in either SD (lysine starvation) or S (lysine and carbon starvation). For imaging, approximately 10,000 cells/well were inoculated into each well of a 96-well plate in the corresponding medium (rapamycin treatment was done in SD + 1 μM rapamycin). The microtiter plate was imaged periodically (approximately 1–2 h) under a 10× objective in a Nikon Eclipse TE-2000U inverted fluorescence microscope (Nikon, Tokyo, Japan) using an ET DsRed filter cube (exciter: ET545/30x, emitter: ET620/60m, Dichroic: T570LP). A similar protocol was followed for experiments in Fig 6 and S9, S10 and S11 Figs, with genotypes and starvation conditions noted in the corresponding figure legends.

Chemostats and turbidostats

Cells were grown under controlled conditions using a custom-made continuous culturing device (S14A Fig), with 6 channels (S14C Fig) of which each can be independently operated as a chemostat or a turbidostat. When operated as a chemostat, a channel provides a limited nutrient environment in which the growth rate is held constant. When operated as a turbidostat, a channel maintains a constant cell density while cells grow with an abundant supply of nutrients. For cell growth protocols in these devices, see Methods, “Evolution”.

The continuous culturing device consisted of 6 reactor vessels (S14A Fig, back), each with a volume of approximately 43 mL (S14E Fig) determined by the height of the outflow tube (S14C Fig). A rubber stopper equipped with an inflow tube and a sampling needle covered the top of each vessel (S14C Fig). The vessels were placed in an aluminum mounting frame with 6 receptacles (S14A Fig, back), each equipped with an integrated magnetic stirrer (made from a CPU fan) and an LED-phototransistor optical detector for OD measurements. The vessels were immobilized in the receptacles by adjustable compression rings. A sampling needle passed through a short length of PharMed rubber tubing (S14C Fig). The tubing was held in place by glass tubing inserted into the stopper. Zip ties are used to achieve the proper tightness, allowing movement of sampling needle while applying enough friction to maintain position. Waste flowed by gravity to a waste receptacle below the device through 0.375-inch inner diameter tubing (Cole Parmer C-Flex) attached to the outflow arm. Nutrient media was fed to each vessel from an independent reservoir by a peristaltic pump (Welco WPM1, operated at 7V DC Welco, Tokyo, Japan). The media delivery tube consisted of 2 sections of generic 2-mm outer diameter, 1-mm inner diameter PTFE tubing, joined by insertion into the 2 ends of a 17-cm section of PharMed AY242409 tubing (Saint-Gobain, Courbevoie, France) which was inserted into the peristaltic pump (S14B Fig). The pump was activated and deactivated by the custom LabView program through a relay box (Pencom Design, UB-RLY-ISO-EXT-LR Trumbauersville, PA, USA). Depending on whether a given channel was in chemostat or turbidostat mode, the LabView program controlled the pump in different ways (i.e., constant dilution rate in chemostat, or dilution to a set turbidity in turbidostat). Data for OD and flow rate were logged in for either mode of operation. In both cases, flow rate can be used to calculate growth rate. Media reservoirs (S14A Fig, front) were 1-L glass bottles capped with one-hole rubber stoppers, and a section of glass tubing was used as a sleeve to prevent curling of the PTFE tubing and to keep the end of PTFE tubing touching the bottom of the reservoir. Each reservoir was placed on a digital balance (Ohaus SPX2201 Parsippany, NJ, USA) with a digital interface (Ohaus Scout RS232 interface) for measurement of the volume (weight) remaining in the reservoir at any given time.

When in turbidostat mode, constant average turbidity was maintained. Specifically, the pump was activated when the measured OD was above the set point and deactivated when the OD was below set point. OD was measured using a 940-nm LED (Ledtech UT188X-81-940, driven with 50-ma current Taiwan, Taiwan) and phototransistor (Ledtech LT959X-91-0125). Each LED-phototransistor pair was tested and selected for consistent OD measurements. The LED and phototransistor were positioned by mounting holes on the aluminum metal frame, on opposite sides of the reactor vessel, 4 cm from the vessel bottom. Each phototransistor was connected to an op-amp (LM324) circuit that acted as a current to voltage converter and buffer (S14B Fig). An isolated DC–DC converter provided a regulated voltage supply for the electronics. The output voltage from the photodetector circuit was digitized using a DAQ (National Instruments USB-6009 Austin, TX, USA) and read by the LabView program for OD measurement. The LabView program stored the average light intensity I0 over the first 2 minutes after starting a channel as the “blank” value. The light intensity, I, was measured every approximately 30 s, and the OD = log10(I/I0) was calculated.

When in chemostat mode, a constant average flow rate f of medium into the vessel was maintained. Unlike our earlier chemostat setup [77], here, constant flow rate was achieved via a scale (Ohaus SPX2201) that constantly weighed its associated reservoir, and the reading was acquired through an RS232 interface (Ohaus Scout RS232). The initial scale reading, Minitial, was recorded when the chemostat channel was activated or reset. This was used with the current scale reading Mcurrent to calculate the total volume pumped from the reservoir to the vessel as 1 ml/g × (McurrentMinitial). The target volume that should have flown from the reservoir to the vessel at the current time was calculated according to the preset flow rate. If the total volume was less than the target, the pump was activated, and otherwise, the pump was deactivated. This provided the correct average flow rate. The flow rate was chosen for the desired doubling time, f = ln(2) × V/TD, where V is the volume of the vessel and TD the doubling time. Vessel volumes were calculated by weighing an empty vessel and then weighing it again when filled to the spillover point (S14E Fig), giving an average value of 43 ml. Individual flow rates were determined using individual vessel volumes. Volume measurements are limited by the minimum waste tube drop size of approximately 0.5 ml, which is constrained by surface tension. Scale readings were logged, providing a measure of flow rate (S14D Fig).

Bioassays

Most bioassays are yield-based. WY1604 (met10 − ) usually served as the tester strain unless otherwise specified in an experiment (see S5 Fig and S1 Table), but preparation for all yield-based bioassays was the same. Strains were grown for approximately 16 hours in 3 mL SD, with any required supplements added. During this time, growth rate was tracked to ensure cells were doubling as expected (1.6- to 3-hour doubling depending on the strain/condition). After this time, cells were given 3–5 washes with 3 mL SD + 164 μM lysine (lacking any organosulfur supplements) and starved for at least 3 hours at 30°C in 3 mL SD + 164 μM lysine to deplete cellular reserves of organosulfurs. Starvation was carried out in a factory-clean 13-mm test tube to prevent inadvertent nutrient contamination. Finally, approximately 1,000 cells/well were inoculated in a flat-bottomed 96-well plate into a final volume of 150 μL of either a metabolite standard or a chemostat supernatant, supplemented with SD + 164 μM lysine. For each auxotrophic strain, SD + 164 μM lysine supplemented with various known concentrations glutathione were used to establish a standard curve that related organosulfur concentration (in terms of fmole GSH equivalent) to final turbidity (S5 Fig). Turbidity achieved in a supernatant was then used to infer organosulfur concentration in the supernatant. Plates were wrapped with parafilm to prevent evaporation and incubated at 30°C for 2–3 days. We resuspended cells using a Thermo Fisher Scientific Teleshake (setting #5 for approximately 1 min) and read culture turbidity using a BioTek Synergy MX plate reader (Winooski, VT, USA).

In a rate-based bioassay (S4B Fig), mCherry-tagged yeast strain auxotrophic for organosulfur (WY2035) was pregrown in SD + 164 μM lysine + 134 μM methionine, and growth rate was tracked by optical density to ensure the cell was growing as expected. Next, cells were washed 3 times in SD + 164 μM lysine (lacking organosulfur supplements) and starved for at least 3 hours in factory-clean 13-mm test tubes. OD was measured again, and cells were inoculated to roughly 1,000 cells/well in a 96-well plate in a total volume of 300 μL. The well was filled with either known quantities of organosulfur (methionine or glutathione) or harvested supernatants, both supplemented into SD + 164 μM lysine. The 96-well plate was measured in the same manner as previously outlined in the “Fluorescence microscopy” section.

Maximal growth rate was calculated by measuring the slope of ln(Normalized Intensity) against time. For each sliding window of 4 time points, slope is calculated, and if it exceeds the current max slope for the well, it is chosen as the new maximum. To ensure that no estimation occurs when other metabolites such as glucose could be limiting, we restricted analysis to data at 25% maximal intensity to ensure that cells had at least 2 doublings beyond when they are theoretically growing maximally. For rate-based bioassays, maximal growth rates were used to estimate approximate niche size.

Flow cytometry

Detailed description can be found elsewhere [30]. Population compositions were measured by flow cytometry using a DxP10 (Cytek, Fremont, CA, USA). Fluorescent beads of known concentration (as determined by hemocytometer) were added to determine cell densities. A final 1:20,000 dilution of ToPro3 (Molecular Probes T-3605 Eugene, OR, USA) was used for each sample to determine live- and dead-cell densities. Analysis using FlowJo software showed obvious clustering of live and dead cells in the ToPro3 RedFL1 channel, with dead cells having a RedFL1 signal of >10 3 . Dead-cell densities typically were never higher than 10% in all conditions tested.

Metabolite extraction

Metabolite extraction for intracellular organosulfur quantification was adapted from [78]. Briefly, 20 mL of chemostat populations was harvested with disposable 25-mL pipettes and rapidly vacuum filtered onto precut 0.45-μm Magna nylon filters (GVS Life Sciences, Sanford, ME, USA). Using ethanol-cleaned forceps, the filter was then quickly submerged into 3 mL ice-cold extraction mixture—40% (v/v) acetonitrile, 40% (v/v) methanol, and 20% (v/v) distilled water—held in a sterile 5-mL centrifuge tube. All reagents were HPLC-grade, and all extraction mixtures were made fresh before each extraction. The centrifuge tube was capped and quickly vortexed to dislodge all cells, and the filter membrane was discarded. The entire process took less than 25 seconds, with the time between populations being filtered and submerged in extraction buffer being less than 10 seconds. After all populations had been harvested, extracts were frozen at −80°C or in liquid nitrogen until solid, transferred to ice, and allowed to thaw. After the samples had thawed, they were incubated on ice for 10 minutes and vortexed once every approximately 3 minutes and returned to −80°C for refreezing (a single “freeze-thaw” cycle). After 3 freeze-thaw cycles, 1.5 mL of sample was harvested and transferred to a new 1.5-mL microcentrifuge tube and centrifuged at 13,000 rpm for 2 minutes at 4°C to pellet the cell debris. The extract was removed, and the remaining cell pellet was extracted again with 1.5 mL of extraction mixture and spun down. The final result was 3 mL of extracted metabolites that was stored at −80°C and analyzed by HPLC less than 48 hours after extraction. For bioassays, this extract was diluted 10-fold in sterile water or SD. To check that a majority of metabolites were extracted, 100 μL of fresh extraction buffer was added to the collected cell debris, vortexed vigorously, and collected by centrifugation. This 100 μL “second extract” was also analyzed for glutathione by HPLC. On average, the amount of glutathione in the second extract was <2% of the amount extracted initially in the 3 mL extraction.

A modified protocol was used for ade − cell extracts. We independently verified that the 2 protocols led to comparable results in the met10 yield-based bioassay (S5 Data). ade − chemostat cultures were filtered on 0.45-μm nitrocellulose membranes (Bio-Rad, Hercules, CA, USA), resuspended in extraction mixture, and flash-frozen in liquid nitrogen. Samples were thawed at −20°C over 30 minutes, with vortexing every 5 minutes. Cell debris were pelleted by centrifugation at 13,000 rpm for 10 minutes at 4°C. After the supernatant was transferred to a fresh tube, the pellet was extracted with half the original volume of extraction mixture, and the supernatants from the 2 rounds of extraction were combined. The extraction mixture was dried off using the low temperature setting on a speed-vac, and dehydrated components were resuspended in sterile distilled water.

From the total amount of metabolites in the sample and the total number of cells used to extract metabolites, we can calculate the average amount of metabolite per cell.

Analytical chemistry quantification of GSH and GSXs

Reduced glutathione was derivatized using a thiol-specific probe first described by [79], called Thiol Probe IV (EMD Millipore, Burlington, MA, USA) to make a fluorescent glutathione conjugate. The compound reacts readily with free thiols, though at different rates. For quantifying glutathione, 270 μL of sample or GSH standard in SD was added to 30 μL of 833 mM HEPES buffer (pH 7.8). This was done to raise the pH of the sample to a basic level, which facilitates the reaction. Next, the probe (dissolved in DMSO and stored in 50-μL aliquots at −20°C), was added to a final concentration of 100 μM, which is in excess of glutathione by at least 10-fold. The reaction was performed at room temperature in the dark (the probe is light-sensitive) in a 96-well plate for 20 minutes. After this, 8.4 μL of 2M HCl was added to rapidly quench the reaction by lowering the pH to approximately 2. This also stabilizes the fluorescent conjugate. The entire sample was then added to a 250-μL small volume pulled point class insert (Agilent Part No: 5183–2085 Santa Clara, CA, USA) to facilitate autosampler needle access. The small volume insert with sample was then placed inside a dark brown 1.5-mL autosampler vial (Shimadzu part number: 228-45450-91 Kyoto, Japan) and capped with a fresh 9-mm screw cap with PTFE septum (Shimadzu part number: 228-45454-91).

Derivatized glutathione was separated and identified using reverse phase chromatography. 10 μL of the reaction mixture was injected onto a Synergi 4-μM Hydro-RP 80-Å LC Column, 150 × 4.6 mm (Phenomenex, Part No: 00F-4375-E0 Torrance, CA, USA), fitted with a SecurityGuard Cartridges AQ C18 4 x 3.00 mm ID (Phenomenex, Part No: AJO-7511) in a SecurityGuard Cartridge Holder (Phenomenex, Part No: KJ0-4282). The SecurityGuard (precolumn) was periodically replaced whenever pressure reading exceeded the manufacturer’s specifications. Glutathione was eluted from the column with a mobile phase gradient of filtered Millipore water (Solution A) and acetonitrile (Solution B, HPLC-grade). The Millipore water was filtered through a 0.22-μM filter prior to use. Additionally, before each run, the column was equilibrated for 30 minutes with 1% Solution B. The percentage of Solution B followed the following program for each injection: 0 min 1%, 10 min 14%, 10.01 min 1%, and 15 min 1%, corresponding to a gradual increase to 14% Solution B over 10 minutes, followed by a re-equilibration with 1% Solution B. The column was maintained at a running temperature of 25°C in a Nexera X2 CTO-20A oven (Shimadzu). Flow rate was 1 mL /min. Under these conditions, glutathione eluted at approximately 7 minutes, with slight run-to-run variation. Fluorescent glutathione was detected by excitation at 400 nm and emission at 465 nm. After each run, the column was washed and stored per manufacturer’s instructions.

Analysis of HPLC data was done using the R Statistical Language with custom-written software for peak-picking, baseline correction, plotting, and area estimation, which is freely available at

Supernatants were shipped overnight on dry ice to the Rabinowitz lab at Princeton University. Stable isotope compound [2- 13 C, 15 N] GSH was obtained from Cambridge Isotope Laboratories. HPLC-grade water, methanol, and acetonitrile were obtained from Thermo Fisher Scientific. Supernatant sample was thawed at room temperature and 30 μL of the supernatant together with 5 μL of 10 μM 2- 13 C + 15 N-labeled GSH was transferred into a 1.5-mL centrifuge tube. The samples were either run directly to measure GSH only or first treated with tris(2-carboxyethyl)phosphine (TCEP) to reduce GSX to GSH before measuring total GSH. For those samples with TCEP treatment, 5 μL of 60 g/L TCEP solution (reducing reagent) was added into the sample. The resulting mixture was vortexed and incubated for 20 minutes at room temperature. Afterward, 10 μL of 15% NH4HCO3 (w/v) was introduced to neutralize the pH of the solvent. The solution was dried down under N2 flow, resuspended in 50 μL 40:40:20 (methanol/acetonitrile/water) solvent, and kept at 4°C in an autosampler.

Samples were analyzed using a Q Exactive Plus mass spectrometer coupled to Vanquish UHPLC system (Thermo Fisher Scientific). LC separation was achieved using a XBridge BEH Amide column (2.1 mm × 150 mm, 2.5-μm particle size, 130-Å pore size Waters, Milford, MA, USA) using a gradient of solvent A (20 mM ammonium acetate + 20 mM ammonium hydroxide in 95:5 water/acetonitrile [pH 9.45]) and solvent B (acetonitrile). Flow rate was 150 μl/min. The gradient was 0 min, 90% B 2 min, 90% B 5 min, 50% B 10 min, 0% B 13.5 min, 0% B 15 min, 90% B 20 min, 90% B. The column temperature was 25°C, and the injection volume was 10 μL. The mass spectrometer parameters are positive ion mode, resolution 140,000 at m/z 200, scan range m/z 290–650, AGC target 3E6, maximum injection time 200 ms. Quantitation of GSH concentrations in samples were achieved by comparing the peak areas of glutathione to those of 13 C-GSH. Data were analyzed using the MAVEN software [80].

Competition

To quantify multiple competition replicates at multiple initial strain ratios, we used the coculture system to mimic the lysine-limited environment, especially because similar mutations in coculture and monoculture lysine-limited chemostats meant that the environments were similar. To do so, WY1340 (the purine-requiring/lysine-releasing strain in the RM11 background) was grown to exponential phase overnight in SD + 134 μM adenine, washed 3 times with SD to remove adenine, and starved for 24 hours to deplete vacuolar storage. During this starvation, WY2072/2073 (BFP met10-evolved clones) and WY2429 (mCherry MET10-evolved clone) were grown overnight in SD + 134 μM methionine to exponential phase and washed 3 times with SD to remove excess methionine and lysine. Both WY2072/3 and WY2429 overproduce and release hypoxanthine which can support the growth of the partner strain WY1340. Next, WY2072/3 and WY2429 were mixed in ratios of 1:100, 1:10, 1:1, and 10:1 to a final OD600 of 0.1. This mixture of populations was then added 1:1 with WY1340 to a final OD600 of 0.03. This was considered generation 0. Populations were monitored for growth by measuring optical density over time and periodically diluted back to OD600 0.03 (OD600 was never greater than 0.45 to ensure no additional metabolites from SD was limiting). The OD600 data were used to back-calculate total generations in the experiment. Periodically, 100 μL of the culture was sampled for flow cytometry to track strain ratios. Experiments were performed until the strain ratio stabilized.

Autophagy assay

Autophagy activities were measured using the GFP-Atg8 cleavage assay [28]. Yeast strains with ura3 deletion in lys − and lysmet17 − background were generated via crosses and transformed with GFP-Atg8 plasmid (Addgene 49425 Watertown, MA, USA) to generate the 2 strains used in the autophagy assays—WY2520 (lys − ) and WY2521 (lysorgS − ). This plasmid expresses ATG8 with an N-terminal GFP tag under the endogenous promoter in a pRS416 vector with a URA3 selection marker [81]. For every experiment, WY2520 and WY2521 were streaked on SC-Ura [74] plates from frozen stocks and saturated overnights were grown from single colonies in SC-Ura medium. Cultures of 25–50 mL volume were inoculated from the overnights in SD + 164 μM lysine (WY2520) or SD + 164 μM lysine + 134 μM GSH (WY2521) in conical flasks and grown for 18–20 hours at 30°C to a desirable cell density. In accordance with published protocols, the initial trials aimed at a starting OD of 0.7–1.0 for starvation. However, we observed that high cell densities could result in higher GFP-Atg8 cleavage even in unstarved cells. Thus, in subsequent trials, starvation was initiated at an OD in the range of 0.2–0.6. The cells were pelleted in 50-mL falcon tubes and washed thrice in sterile milliQ water. After the washes, cells were resuspended in the starvation medium of choice (see details below) in factory-clean tubes at an OD of 0.1–0.2. For the conditions in which cells did not arrest growth upon starvation (primarily organosulfur starvation), cultures were periodically diluted to minimize the influence of secondary nutrient limitations caused by high cell densities. For time-course analysis, starvation was carried out in 10-mL cultures in 18-mm tubes, and 2 mL of the culture was withdrawn for analysis at 24, 48, and 72 hours from the initiation of starvation. For assays with a single time-point sampling, starvation was carried out in 3-mL cultures in 13-mm tubes. lys − cells were starved for 4 or 8 hours, with comparable results observed for both treatments. lysorgS − cells were starved for 72 hours after the time-course analysis revealed that the influence of organosulfur starvation was only discernable after 48 hours in the GFP-Atg8 cleavage assay.

Starvation media for different treatments are described here. For lys − cells, lysine starvation was carried out in SD medium nitrogen starvations were carried out in SD-N medium either supplemented with 164 μM lysine (only nitrogen starvation) or lacking it (double starvation for lysine and nitrogen). For lysorgS − cells, double starvation for lysine and organosulfur was carried out in SD medium, lysine starvation was carried out in SD + 134 μM GSH, and organosulfur starvation was carried out in SD + 164 μM lysine.

Sample preparation was carried out as suggested in [82] with minor modifications. Cells from 2–4 ml of culture were pelleted in a microcentrifuge tube at 5,000 × g for 3 minutes. Cell pellets were flash-frozen in liquid nitrogen and stored in −20°C till all samples had been collected for an experiment. For cell lysis, pellets were resuspended in 1 mL of ice-cold 10% trichloroacetic acid and allowed to stand in a cold metal block on ice for 30–40 minutes. Proteins were pelleted at 16,000 × g for 1 minute at 4°C. The pellets were resuspended in 1 mL cold acetone by vortexing and bath sonication and pelleted again by centrifugation. The acetone wash was repeated once and pellets were allowed to air-dry for 5 minutes before resuspending in SDS-PAGE sample buffer (0.1 M Tris-HCl [pH 7.5], 2% w/v SDS, 10% v/v glycerol, 20 mM DTT). Based on the OD measured at the time of sample collection, the sample buffer volume was adjusted to attain comparable cells/μL in each sample. Acid-washed glass beads (425–600 μm Sigma G8771 Sigma-Aldrich, St. Louis, MO, USA) were added to each tube, roughly equivalent to half the sample volume, and the pellet was resuspended by bead beating for 35 seconds. After centrifugation for 20 minutes to allow the foam to settle, the samples were heated in a 95°C metal block for 10 minutes. After a 3-minute centrifugation at 5,000 × g, samples were run on a 12.5% acrylamide gel for 50 minutes at a constant current of 30 mA. The bands were transferred onto a 0.2-μm PVDF membrane (Bio-Rad Trans-blot 162–0184) using a wet transfer protocol at a constant voltage of 60 V for 2 hours in the cold room. For immunoblotting, the membrane was incubated overnight at 4°C with an anti-GFP monoclonal primary (JL-8 Clontech 632381 Clontech, Takara Bio, Mountain View, CA, USA) at 1:5,000 dilution, followed by a 45-minute room temperature incubation with a horseradish-peroxidase–conjugated anti-mouse secondary (GE Healthcare Lifesciences [now known as Cytiva] Marlborough, MA, USA) at 1:10,000 dilution. Antibodies were detected using the SuperSignal West Dura Chemiluminescent Substrate (Thermo Fisher Scientific). The preinstalled Gel Analyzer plugin on ImageJ was used for quantification of bands.


Functions of the Urinary System


The urinary system produces urine and conducts it to outside the body. As the kidneys produce urine, they carry out four functions: excretion of metabolic wastes, maintenance of water-salt balance, maintenance of acid-base balance, and secretion of hormones.

Excretion of Metabolic Wastes
The kidneys excrete metabolic wastes, notably nitrogenous wastes. Urea is the primary nitrogenous end product of metabolism in human beings, but humans also excrete some ammonium, creatinine, and uric acid. Urea is a by-product of amino acid metabolism. The breakdown of amino acids in the liver releases ammonia, which the liver combines with carbon dioxide to produce urea. Ammonia is very toxic to cells, but urea is much less toxic. Because it is less toxic, less water is required to excrete urea. Creatine phosphate is a high-energy phosphate reserve molecule in muscles. The metabolic breakdown of creatine phosphate results in creatinine. The breakdown of nucleotides, such as those containing adenine and thymine, produces uric acid. Uric acid is rather insoluble. If too much uric acid is present in blood, crystals form and precipitate out. Crystals of uric acid sometimes collect in the joints, producing a painful ailment called gout.

Maintenance of Water-Salt Balance
A principal function of the kidneys is to maintain the appropriate water-salt balance of the blood. As we shall see, blood volume is intimately associated with the salt balance of the body. As you know, salts, such as NaCl, have the ability to cause osmosis, the diffusion of water-in this case, into the blood. The more salts there are in the blood, the greater the blood volume and the greater the blood pressure. In this way, the kidneys are involved in regulating blood pressure. The kidneys also maintain the appropriate level of other ions (electrolytes), such as potassium ions (K + ), bicarbonate ions (HCO 3 - ), and calcium ions (Ca 2 + ), in the blood.

Kidneys
The kidneys are paired organs located near the small of the back in the lumbar region on either side of the vertebral column. They lie in depressions against the deep muscles of the back beneath the peritoneum, where they receive some protection from the lower rib cage. Each kidney is usually held in place by connective tissue, called renal fascia. Masses of adipose tissue adhere to each kidney. A sharp blow to the back can dislodge a kidney, which is then called a floating kidney. The kidneys are bean-shaped and reddish-brown in color. The fist-sized organs are covered by a tough capsule of fibrous connective tissue, called a renal capsule. The concave side of a kidney has a depression called the hilum where a renal artery enters and a renal vein and a ureter exit the kidney.

Ureters
The ureters, which extend from the kidneys to the bladder, are small, muscular tubes about 25 cm long and 5 mm in diameter. Each descends behind the parietal peritoneum, from the hilum of a kidney, to enter the bladder posteriorly at its inferior surface. The wall of a ureter has three layers. The inner layer is a mucosa (mucous membrane), the middle layer consists of smooth muscle, and the outer layer is a fibrous coat of connective tissue. Peristaltic contractions cause urine to enter the bladder even if a person is lying down. Urine enters the bladder in spurts that occur at the rate of one to five per minute.

Urinary Bladder
The urinary bladder is located in the pelvic cavity, below the parietal peritoneum and just posterior to the pubic symphysis. In males, it is directly anterior to the rectum in females, it is anterior to the vagina and inferior to the uterus. Its function is to store urine until it is expelled from the body. The bladder has three openings-two for the ureters and one for the urethra, which drains the bladder. The trigone is a smooth triangular area at the base of the bladder outlined by these three openings (Fig. 16.2) . Collectively, the muscle layers of the bladder wall are called the detrusor muscle. The wall contains a middle layer of circular fiber and two layers of longitudinal muscle, and it can expand. The transitional epithelium of the mucosa becomes thinner, and folds in the mucosa called rugae disappear as the bladder enlarges. The bladder has other features that allow it to retain urine. After urine enters the bladder from a ureter, small folds of bladder mucosa act like a valve to prevent backward flow. Two sphincters in close proximity are found where the urethra exits the bladder. The internal sphincter occurs around the opening to the urethra. Inferior to the internal sphincter, the external sphincter is composed of skeletal muscle that can be voluntarily controlled.

Urethra
The urethra is a small tube that extends from the urinary bladder to an external opening. The urethra is a different length in females than in males. In females, the urethra is only about 4 cm long. The short length of the female urethra makes bacterial invasion easier and helps explain why females are more prone to urinary tract infections than males. In males, the urethra averages 20 cm when the penis is flaccid (limp, nonerect). As the urethra leaves the male urinary bladder, it is encircled by the prostate gland. In older men, enlargement of the prostate gland can restrict urination. A surgical procedure can usually correct the condition and restore a normal flow of urine. In females, the reproductive and urinary systems are not connected. In males, the urethra carries urine during urination and sperm during ejaculation. This double function of the urethra in males does not alter the path of urine.

Urination
When the urinary bladder fills to about 250 ml with urine, stretch receptors send sensory nerve impulses to the spinal cord. Subsequently, motor nerve impulses from the spinal cord cause the urinary bladder to contract and the sphincters to relax so that urination, also called micturition, is possible (Fig. 16.2) . In older children and adults, the brain controls this reflex, delaying urination until a suitable time.

Maintenance of Acid-Base Balance
The kidneys regulate the acid-base balance of the blood. In order for a person to remain healthy, the blood pH should be just about 7.4. The kidneys monitor and control blood pH, mainly by excreting hydrogen ions (H + ) and reabsorbing the bicarbonate ions (HCO 3 - ) as needed to keep blood pH at about 7.4. Urine usually has a pH of 6 or lower because our diet often contains acidic foods.

Secretion of Hormones
The kidneys assist the endocrine system in hormone secretion. The kidneys release renin, a substance that leads to the secretion of the hormone aldosterone from the adrenal cortex, the outer portion of the adrenal glands, which lie atop the kidneys. Aldosterone promotes the reabsorption of sodium ions (Na + ) by the kidneys. Whenever the oxygen-carrying capacity of the blood is reduced, the kidneys secrete the hormone erythropoietin, which stimulates red blood cell production. The kidneys also help activate vitamin D from the skin. Vitamin D is the precursor of the hormone calcitriol, which promotes calcium (Ca 2 + ) absorption from the digestive tract.

Organs of the Urinary System
The urinary system consists of the kidneys, ureters, urinary bladder, and urethra. Figure 16.1 shows these organs and also traces the path of urine.


Structured Question Worked Solutions

1. Describe 3 ways in which smoking damages the lungs

  • Tar deposited in lungs contains carcinogens and increases risk of lung cancer
  • Carbon monoxide in smoke increases fat deposition, if at coronary arteries, the lumen of the arteries gets narrower and decreases blood supply, leading to heart attack
  • Irritants cause coughing. Prolonged violent coughing could lead to emphysema in which the alveolar walls break down

Volume of gas produced in syringe (cm 3 )

(b) From the results in table 1, suggest which sugar would be a better respiratory substrate for yeast.

(c) Suggest why there is a difference in the rate of respiration when yeast is given different sugars in the experiment.

(d) Highlight any anomalous data in the results.

(e) Name a possible error in this experiment and suggest an improvement or solution.

(b) Glucose. It gives a higher volume of carbon dioxide gas than sucrose in the same time period, indicating that it can be utilized more quickly.

(c) The raw material used in respiration is glucose. Sucrose is a disaccharide and has to be first broken down into glucose before it can be used in respiration. Therefore, the rate of respiration using sucrose is lower than that of glucose.

(d) The reading at 5 min for replicate 1 of glucose. It is much higher than the reading of replicate 2.

(e) Some of the released carbon dioxide may not be recorded as air can be compressed use datalogger instead. Carbon dioxide is slightly soluble in water and may dissolve in the mixture use a hydrogencarbonate indicator instead .

3. Figure 2 shows the effect of lactic acid on the amount of oxygen released by red blood cells to actively respiring muscle cells.

(a) Explain why lactic acid is formed during vigorous muscular activity.

(b) With reference to fig. 2, explain how an increased concentration of lactic acid affects the release of oxygen to the muscle cells.

(c) How is lactic acid removed by the body?

(a) During vigorous muscular activity, aerobic respiration alone is not enough to meet the increased energy demand. Anaerobic respiration takes place in the muscle cells to supplement the energy from aerobic respiration. Anaerobic respiration in muscle cells produces lactic acid.

(b) When there is an increased concentration of lactic acid, the percentage of oxyhaemoglobin in the blood decreases. This indicates that more oxygen is released from haemoglobin to the muscle cells.

(c) Lactic acid is removed by the body either through oxidation to produce energy, or conversion to glucose in the liver.

4a. What are the symptoms of emphysema?

4b. Name a cause of emphysema

4a. breathing difficulty, wheezing, breathlessness

5. Explain the importane of each of the following in relation to their function in respiration


Watch the video: Metabolism u0026 Nutrition, Part 1: Crash Course Au0026P #36 (October 2022).