Information

Can primers for PCR be duplicated?

Can primers for PCR be duplicated?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Complete beginner question here, don't laugh: If I have some primers that have been synthesized, and I am close to running out of them, is there any way to duplicate them / amplify them / synthesize more of them myself? I don't know the sequences. Or is my only option to buy more? Thanks


Short answer: You need to buy some more, but you need the sequence also for ordering.

Long answer: The Taq polymerase needs a piece of DNA (or RNA) to prime the reaction and be able to enlarge the DNA chain, this is why we use primers in the first place (also to ensure reaction specificity to the region we want to amplify). To enable the reaction you would need a primer complimentary to the one you used of about the same length (or at least not much shorter), so this actually doesn't really make sense, because you would have to have a primer to make your primer. Since primers are cheap today, order some more.


Marine Enzymes and Specialized Metabolism - Part A

Michael F. Freeman , in Methods in Enzymology , 2018

2.2.2 Buffers, Solutions, and Reagents

Plasmid pLMB51 (Addgene #40083)

Phusion DNA polymerase and supplied buffer

Deoxyribonucleotides (dNTPs, 10 mM each)

TAE agarose gel with 0.5 μg/mL ethidium bromide or equivalent, TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA, pH 8.0)

Restriction enzymes BamHI-HF, XbaI, BglII, SpeI-HF, and associated buffers

E. coli cloning strain such as DH5α

Lysogeny broth (LB) medium and LB-agar plates with 100 μg/mL of ampicillin (final concentration)


Repeated mutagensis primer in site-directed mutagenesis - (Oct/07/2013 )

Im trying to create point mutation in domain of gene of interest using enzynomics EZ-MIX kit. I believe this kit follow quick-change site directed mutagenesis method PCR amplification of forward-reserve complemantary primer with the introduction of mutation in the middle of primer, follow by dpn1 digestion.

I am able to get the colonies after transformation but when i sent two clones for sequencing, sequencing result turn out there is repeated region of whole mutagenesis primer in both clones. May i know if anyone had experience this and how to overcome this problem. Im thikning sending more clones for sequencing may help.Thanks!!

I should mentioned that im able to get the point mutation, but the whole primer region duplicated. thanks!!

Do you mean that you have two duplicates of your mutation in your gene? I am having trouble understanding what you mean.

I think he's saying he has the sequence that is complementary to the mutagenesis primers duplicated in his result. Probably including the mutation he wanted.

I can imagine only two ways how this would happen, the sequence near the mutation site is highly similar and primers bind to them to, but this would be incompatible with the polymareration process. The other is the new strands somehow disaligned at nicked sites probably because the ends are complementary and duplicated the sequence during the plasmid repair in the bacterial cells.

Definitelly try more clones. But if you could post at least primer sequences, it would be possible to tell whether primers are the problem.

Thank you for the reply. Attached is the primers i used for the site-directed mutagenesis. Red color triple codon is the point mutation that i introduced instead of its original TAC triplet codon. I design the primer by myself and the primer isnt purified as may required in site-directed mutagenesis.

5’- AAACAAATTTG TTG ATTGGGTTCTT

This whole 25bp primer are duplicated or triplicated in the colonies sequences after transformation. For eg, instead of flanking-AAACAAATTTG TTG ATTGGGTTCTT-flanking, now it become flanking-AAACAAATTTG TTG ATTGGGTTCTTAAACAAATTTG TTG ATTGGGTTCTT-flanking. i had screen more clones but couldnt found normal clones. Im not sure if its due to primer annealing since whole region instead of partial region are duplicated.

I will appreciate if anyone could give me suggestions. Thank you

That is weird that you get perfect insertion of the primer multiple times.  One can see binding of the two primers when you run them through a dimer prediction program, but it doesn't match up with what you are seeing:

Thermo Scientific, Self-Dimers:

Are the 5' and 3' regions of your insertion site similar that would allow multiple insertions?

Does the mutagenesis kit say that a 25bp primer is sufficient for a 2bp mutation? My protocols usually required >40bp for correct mutation.

Your results are weird to say the least.  Could you provide some sequence info on your 3' and 5' gene sequence?

Was there ever any resolution to this issue? Any new thoughts? I just performed a site-directed mutagenesis and I am experiencing the same phenomenon - repetition of a sequence containing the mutant. 

I don't think there was any resolution - but it looks to me like there could possibly be some complementation of the OP's primers that could potentially lead to duplication of the site of interest.

I have observed this on multiple occasions. I have never figured out a solution, other than screening more colonies. When this happened, it was usually 1 out 5 colonies that I had sent for sequencing. I use much higher concentration of primer than what is recommended. I use roughly 4-5uM primer in the reaction which is much higher compared to my normal PCR. If I had to guess why this occurs, I think the high concentration of primer can cause this strange result.


Polymerase Chain Reaction (PCR): Biology Notes on PCR

PCR provides a simple and ingenious method for exponential amplification of speci­fic DNA sequences by in vitro DNA synthesis, i.e., this technique has made it possible to synthesize large quantities of DNA fragments without cloning it.

Kary Mulis in 1985 developed the technique based on the use of an enzyme which is named as Taq DNA polymerase. The PCR technique has now been automated and is carried out by a speci­ally designed machine.

The technique involves the following three steps (Fig. 22.16):

i. Denaturation of DNA Fragment:

The target DNA containing sequence to be amplified is heat denatured (around 94°C for 15 sec) to separate its complementary strands, this process is called melting of target DNA.

ii. Annealing of Primers:

Primers are added in excess and the temperature is lowered to about 68°C for 60 sec., as a result the primers form the hydrogen bonds and anneal to the DNA on both sides of the DNA sequence.

Finally different nucleoside triphosphate (dATP, dGTP, dCTP, dTTP) and a thermo-stable DNA polymerase (Taq polymerase from Thermus aquaticus and Vent polymerase from Thermococcus litoralis) are added to the reaction mixture, it helps in polymerization process of primers and, therefore, extends the primers (at 68°C) resul­ting in synthesis of multiple copies of target DNA sequence.

After completion of all these steps in one cycle, again the second cycle is repeated following the same process. If 20 such cycles occur, then about one million copies of target DNA sequence are produced. Recently this technology has been improved much more, where instead of Taq polymerase the rTth polymerase is used which transcribe RNA to DNA, and thereafter amplify the DNA.

Modified Forms of PCR:

The conventional PCR is the symmetrical PCR technique. There are some other modified forms of PCR which are used for various purposes:

AP-PCR (Arbitrarily Primed Polymerase Chain Reaction):

It requires only a single primer of rela­tively much smaller length compared to the primers used in PCR. This tech­nique is used for DNA profiling, in animal and plant biotechnology as well as in forensic medicine.

Target seque­nces of one strand may be amplified in several orders of magnitude more as compared to its complementary strand. This approach is particularly useful for generating single stranded DNA fragment to be used for sequencing of DNA.

IPCR (Inverted Polymerase Chain Reaction):

In this method it allows the amplifica­tion of DNA flanking a known DNA sequence, the primers are facing outwards. Using the inverse PCR, the unknown sequences flanking known sequences can be readily amplified.

RT-PCR (Reverse Transcriptase Polymerase Chain Reaction):

Although the PCR amplification is generally performed on the DNA template but using this technique the RNA also can be used for amplification. This technique is particularly useful for study­ing the expression of genes and for monitoring the obscure species of mRNA.

Nested PCR primers are ones that are internal to the first primer pair. The larger fragments produced by the first round of PCR is used as the template for the second PCR. This technique eliminates any spurious non-specific amplification products.

Application of PCR in Biotechnology:

PCR has many fold applications.

1. The amplification of gene fragments as fast alternative of cloning:

(a) Inserts of bacterial plasmids can be amplified with primers.

(b) DNA from known sequence can be obtained by designing primers.

(c) PCR helps in identification of homologous sequences from related organisms.

(d) Using RT-PCR the 3′ end of cDNA can be amplified (RACE: Rapid Amplification of cDNA Ends).

(e) Reverse PCR helps to know the flanking sequences of a known DNA clone.

2. Modification of DNA Fragments:

Site directed mutagenesis using oligonucleotides as PCR primers provides a powerful approach to study structure-function relation.

3. Diagnosis of Pathogenic Microorganism:

DNA from the infected parts of a person or animal may be subjected to PCR with primer specific gene of the pathogen and diag­nosis can be done on amplification of DNA.

4. DNA Analysis of Archaeological Specimens:

As DNA is relatively stable and remain intact for a long period of time, PCR can help in analysis of DNA from those embed­ded materials.

5. Detection of Mutation Relevant for Inherited Diseases:

Any point mutation, a deletion or an insertion and expanded tandem trinucleotide repeat can be detected by PCR. Somatic mutations in oncogenes or tumour repressor genes can also be detected by PCR with primers flanking the insertions or deletions.

6. Analysis of Genetic Markers for Forensic Applications, for paternity testing and for the mapping of hereditary traits.

(b) RAPD (Random Amplified Polymorphic DNA) with arbitrary, often short (10 bp) primers.

7. Species-Specific Amplification of DNA Segments between interspersed repeat elements (IRS) using the primer based on the SINE sequence (Short Interspersed Nuclear Elements).

8. Genetic Engineering using PCR:

Using PCR we can incorporate alteration or muta­tion in the ultimate product by choice altering, removing or adding sequences to the primer at the 5′ end. By recombinant PCR technique, it is possible to join two DNA fragments at a speci­fic site through complementary overlaps (This technique is termed as splicing). By synthesizing two mutagenic primers, spanning the internal site to be changed, it is possible to introduce mutations within a fragment.


DNA Preparation

Molecular cloning involves introducing DNA, as an insert, into a vector molecule. The DNA to be cloned can be obtained by cutting it out of a source DNA by digestion with restriction enzymes, by copying it from a source molecule by either the Polymerase Chain Reaction (PCR) or Reverse Transcription-PCR (RT-PCR), or by assembling it from short DNA pieces (oligonucleotides). These methods all require that the DNA source is sufficiently free of contaminants that could potentially inhibit the enzyme activities (endonucleases, polymerases) involved in processing the DNA for cloning.


Traditional cloning by restriction endonuclease digestion can use any of a number of different source DNA types. Genomic DNA can be digested with a restriction enzyme and cloned into a compatible vector site to produce a library of different inserts, all from the same source DNA. DNA already cloned into one vector can be transferred (subcloned) to a new recipient vector by cutting out the DNA with restriction enzymes and cloning into the corresponding sites of the second vector. This is frequently undertaken to facilitate protein expression or transcription of RNA, for example, which might not be possible from the original vector.

PCR is often used for generating DNA for cloning and frequently restriction sites are incorporated into the primer sites so that the amplified DNA can be digested and cloned into compatible restriction sites of the cloning vector. Any type of DNA containing the desired sequence can serve as the template for PCR. Cloning with two distinct restriction enzymes ensures that non-compatible ends are generated on each molecule, thereby preventing simple vector recircularization and forcing inserts to be cloned directionally. This can be important for ensuring a translational open reading frame for protein expression. Modification of DNA ends following restriction digestion can be helpful in certain situations. For example, in non-directional cloning, where a single restriction enzyme is used, dephosphorylation of the digested vector DNA will prevent recircularization of the vector, thereby increasing the proportion of the desired recombinant DNA molecules.

PCR is increasingly used for preparing DNA for cloning applications. Amplified DNA can either be cloned directly, or following restriction digestion with restriction sites engineered into the primers used for PCR. Alternatively, amplified DNA can be used in Seamless Cloning strategies such as NEBuilder HiFi DNA Assembly or in Ligation Independent Cloning. The vector molecules for these cloning methods may also be produced by PCR. DNA amplified with Taq polymerase has a template-independent single adenosine (A) added at the 3&rsquo ends which allows cloning into complementary T-tailed vectors. High-fidelity proofreading polymerases do not add additional bases allowing cloning of the amplified DNA into blunt-ended restriction sites. Depending on the chosen cloning strategy, the ends of amplified DNA can be modified by A-tailing, blunting, or addition or removal of 5&rsquo-phosphate groups. Complementary DNA (cDNA) generated by reverse transcription of RNA can also be amplified by PCR. This ability to synthesize DNA from RNA templates enables cloning of sequences corresponding to gene transcripts.


EXPERIMENTAL PROCEDURES

Prelaboratory Skills—

For success in this exercise, the following technical skills are required: sterile laboratory technique, accurate pipetting ability, knowledge of techniques for preserving enzyme activity, and use of microcentrifuges and semi-logarithmic paper. Knowledge of DNA replication, PCR, and agarose gel electrophoresis is helpful, but may be provided in a background lecture prior to the laboratory exercise. Students work in groups of two or three at least one member of the group must be male and one must be female.

Equipment—

The laboratory exercise requires a microcentrifuge, two heating water baths, gel electrophoresis equipment (power supplies, horizontal gel boxes, trays, and combs), and one or more thermocyclers with sufficient capacity to accommodate the number of student groups. An ultraviolet light source with an ultraviolet-protective shield is needed to visualize the DNA bands. If available, a gel documentation device or camera can be used to produce a picture of the gel. For the experiments described here, the Mastercycler Gradient thermocycler and 5415C microcentrifuge (Eppendorf, Hamburg, Germany), Mini-Sub Cell GT PowerPac 300 gel electrophoresis system (catalog no. 165-4347 Bio-Rad, Hercules, CA), and IS-1000 Digital Imaging System (Alpha Innotech Corp., San Leandro, CA) were used.

Kits, Enzymes, and Solutions—

The genomic DNA isolation kit (catalog no. SA-40001) and X&Y chromosome primer set kit (catalog no. SP-10704) were purchased from Maxim Biotech. The primer kit provides the two primers, PCR buffer with nucleotides, 100-bp DNA ladder, and human DNA for use as a positive control. Theoretically, each kit contains enough material for 100 assays (33 groups) however, because excess solution is provided to each group, one kit will accommodate 20 to 24 sets of three PCR, including pretesting the experiment. The amount of 100-bp DNA ladder in the kit may be limiting, but additional DNA ladder may be purchased separately from the company. Taq polymerase (5 U/μl) was obtained from Eppendorf. DNA sample loading buffer can be purchased (catalog no. 161-0767 Bio-Rad) or prepared according to standard protocols [ 9 ]. Agarose (SeaKem GTG) was obtained from BioWhittaker Molecular Applications (Rockland, ME). Ethidium bromide (a mutagen) was purchased as a 10 mg/ml solution (Bio-Rad), and the concentrated solution was handled only by the instructor or teaching assistant wearing appropriate gloves. Students were allowed to handle diluted ethidium bromide solutions using gloves with warnings about its mutagenic properties. Other DNA dyes with reportedly less harmful properties are available (Gelstar nucleic acid stain FMC, Philadelphia, PA).

Laboratory Supplies and Set-up—

For each group, the following supplies are required: gloves for handling solutions with ethidium bromide, pipettes and sterile pipette tips for volumes from 2 to 1000 μl, four sterile 1.5-ml microcentrifuge tubes for isolating DNA, two sterile 1-ml pipette tips (or two sterile swabs) for collecting cheek cell samples, three 0.5-ml PCR tubes, and three sterile 0.5-ml microcentrifuge tubes for preparing electrophoresis samples.

Because students often have limited experience in pipetting and handling active enzymes, it may be beneficial to provide individual groups with aliquots of the various solutions used in the procedure. In our laboratories, it was also advantageous to have either the teaching assistant or the instructor add the enzymes. Without these precautions, pipetting errors by students have occasionally resulted in significant losses of expensive enzymes from the stock containers. Alternatively, Taq polymerase can be mixed with the optimized PCR buffer immediately prior to the laboratory period and provided as a PCR buffer/polymerase mix (0.2 μl of Taq polymerase per 30 μl of PCR buffer).

Provide each group of students with an ice bucket containing separate aliquots of labeled components (1.2–2 times the volume specified in the protocol). The solutions and volumes indicated below apply for the Maxim Biotech genomic DNA purification kit. Other kits may also be used. For DNA isolation (day 1), aliquot cell lysis solution (1.5 ml of BD-3 solution), ribonuclease A (25 μl on ice), protein precipitating solution (0.5 ml of BD-4 solution on ice), and 100% ethanol (1.5 ml at room temperature).

For day 2, supply ice-cold 70% ethanol (2.5–3 ml), sterile distilled, deionized water (0.5 ml), primers from the X&Y primer kit (40 μl), 10-fold-diluted human genomic DNA (15 μl), and PCR buffer/polymerase mix (120 μl). For agarose gel electrophoresis (day 3), provide 5 × nucleic acid sample buffer (15 μl) and Tris-acetate-EDTA (TAE)12 2 The abbreviation used is: TAE, Tris-acetate-EDTA. electrophoresis buffer (300 ml of 40 m M Tris acetate, 1 m M EDTA). Also, premix 20 μl of sample buffer with 100 μl of 100-bp DNA ladder, and aliquot 6 μl to each group. To minimize exposure of students to concentrated ethidium bromide solutions, the teaching assistant can melt the agarose (1% in TAE buffer) immediately before the laboratory period, place 50-ml aliquots in heat-resistant disposable 50-ml tubes, add ethidium bromide, and store the tubes in a 65 °C water bath until use.

Safety Concerns—

Ethidium bromide and some other DNA dyes are mutagenic. Wear gloves and avoid contact with these substances. Properly dispose of pipette tips that contact concentrated ethidium bromide. Autoclave all biological samples at the end of the exercise and dispose according to the Environmental Health and Safety policy of the individual campus.

Experimental Procedures—

The manufacturer's instructions for the genomic DNA isolation kit were provided to the students, and the procedure is summarized below. Prepare separate male and female DNA samples. Gently scrape the inside of both cheeks 10 times with a sterile 1-ml pipette tip or a sterile swab. Some solid material and saliva should be visible in the pipette tip. Mix the sample thoroughly with 0.6 ml of cold BD-3 solution (lysis solution) in a sterile 1.5-ml microcentrifuge tube. The lysis solution contains detergent and a strong base to disrupt the cell membrane and release the cellular contents. Homogenize the sample by mixing and then incubate at 65 °C for 30 min. Cool the solution to room temperature and add 10 μl of RNase A solution to digest the RNA molecules present in the sample. Incubate at 37 °C for 20 min and then place the tube on ice for 5 min. Add 0.2 ml of BD-4 solution, which contains a salt that causes the proteins to precipitate through a salting-out effect. Mix well by inverting the tube several times, and centrifuge for 10 min in a microcentrifuge at maximum speed to remove the precipitated proteins. Collect the supernatant containing DNA and transfer to a fresh 1.5-ml microcentrifuge tube. Add 0.6 ml of 100% ethanol at room temperature, and invert the tube 40–50 times to precipitate the DNA. Store the centrifuge tubes at 4 °C until the next laboratory period.

Completion of DNA Isolation and Preparation of the PCR Mixtures—

To complete the DNA isolation, centrifuge the tubes at maximum speed for 10 min and discard the supernatant. The DNA should precipitate, but in most cases will not be visible. Gently pipette 1 ml of ice-cold 70% ethanol into the tube to wash the DNA. Do not mix the contents of the tube. Centrifuge for 5 min, discard the supernatant, and allow the pellet to air-dry. Add 0.2 ml of sterile distilled deionized water. Heat the tube at 65 °C for 20 min, inverting the tube several times during the incubation to dissolve the DNA. If necessary, the DNA sample can be stored at −20 °C, but should not be repeatedly frozen and thawed.

Agarose Gel Electrophoresis—

Provide instructions and materials to enable students to prepare horizontal 1% agarose gels (7 × 10 cm) in TAE buffer. Place the gels in the gel boxes with TAE buffer. Label three sterile microcentrifuge tubes as female, male, or control DNA. Add 3 μl of 5 × sample buffer to each tube. Using a fresh tip for each tube, add 15 μl of each PCR to the appropriately labeled microcentrifuge tube. Mix briefly. Load 15 μl of each mixture into a separate lane on the gel. In the fourth lane, add 5 μl of DNA ladder (molecular size standard) premixed with DNA sample loading buffer. Secure the lid on the gel box and run the gel until the darker blue dye reaches one-half to two-thirds the length of the gel (typically 45 min at 100 V). Turn off the power supply, remove the gel, and record the banding pattern observed with ultraviolet light.


DESIGN PCR PRIMERS

BACKGROUND INFORMATION: For sites describing PCR theory, as well as companies marketing PCR products you might want to begin by visiting Highveld. For PCR techniques see PCRlink.com.

There are several excellent sites for designing PCR primers:

Primer3: WWW primer tool (University of Massachusetts Medical School, U.S.A.) &ndash This site has a very powerful PCR primer design program permitting one considerable control over the nature of the primers, including size of product desired, primer size and Tm range, and presence/absence of a 3&rsquo-GC clamp.
GeneFisher - Interactive PCR Primer Design (Universitat Bielefeld, Germany) - a very good site allowing great control over primer design.

Primer3Plus - a new improved web interface to the popular Primer3 primer design program ( Reference: A. Untergasser et al. 2007. Nucl. Acids Res. 35(Web Server issue):W71-W74)
BiSearch Primer Design and Search Tool - this is a useful tool for primer-design for any DNA template and especially for bisulfite-treated genomes. The ePCR tool provides fast detection of mispriming sites and alternative PCR products in cDNA libraries and native or bisulfite-treated genomes. ( Reference: Arányi T et al. 2006. BMC Bioinformatics 7: 431).

Primer-BLAST was developed at NCBI to help users make primers that are specific to the input PCR template. It uses Primer3 to design PCR primers and then submits them to BLAST search against user-selected database. The blast results are then automatically analyzed to avoid primer pairs that can cause amplification of targets other than the input template.

MFEprimer allows users to check primer specificity against genomic DNA and messenger RNA/complementary DNA sequence databases quickly and easily. This server uses a k-mer index algorithm to accelerate the search process for primer binding sites and uses thermodynamics to evaluate binding stability between each primer and its DNA template. Several important characteristics, such as the sequence, melting temperature and size of each amplicon, either specific or non-specific, are reported. ( Reference: Qu W et al. 2012. Nucl. Acids Res. 40 (Web Server issue): W205-W208)

Primer Design and Search Tool

PrimerDesign-M - includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions. ( Reference: Yoon H & Leitner T. 2015. Bioinformatics 31:1472-1474).

RF-cloning (Restriction-free cloning) - is a PCR-based technology that expands on the QuikChange&trade mutagenesis process originally popularized by Stratagene in the mid-1990s, and allows the insertion of essentially any sequence into any plasmid at any location. ( Reference: Bond SR & Naus CC. 2012. Nucl. Acids Res 40(Web Server issue): W209-W213)

primers4clades - is a pipeline for the design of PCR primers for cross-species amplification of novel sequences from metagenomic DNA or from uncharacterized organisms belonging to user-specified phylogenetic lineages. It implements an extended CODEHOP strategy based on both DNA and protein multiple alignments of coding genes and evaluates thermodynamic properties of the oligonucleotide pairs, as well as the phylogenetic information content of predicted amplicons,computed from the branch support values of maximum likelihood phylogenies. Trees displayed on screen make it easy to target primers to interactively selected clades. ( Reference: Contreras-Moreira B et al. 2009. Nucleic Acids Res. 37(Web Server issue):W95-W100).

TaxMan: Inspect your rRNA amplicons and taxa assignments - In microbiome analyses, often rRNA gene databases are used to assign taxonomic names to sequence reads. The TaxMan server facilitates the analysis of the taxonomic distribution of your reads in two ways. First, you can check what taxonomic names are assigned to the sequences produced by your primers and what taxa you will lose. Second, the produced amplicon sequences with lineages in the FASTA header can be downloaded. This can result in a much more efficient analysis with respect to run time and memory usage, since the amplicon sequences are considerably shorter than the full length rRNA gene sequences. In addition, you can download a lineage file that includes the counts of all taxa for your primers and for the used reference. ( Reference: Brandt, B.W. et al. 2012. Nucleic Acids Research 40:W82-W87).

Oligonucleotide physicochemical parameters:

NetPrimer (Premier Biosoft International, U.S.A.) - In my opinion the best site since it provides one with Tm, thermodynamic properties and most stable hairpin & dimers.BUT it takes a while for the program to load.

dnaMATE - calculates a consensus Tm for short DNA sequence (16-30 nts) using a merged method that is based on three different thermodynamic tables. The consensus Tm value is a robust and accurate estimation of melting temperature for short DNA sequences of practical application in molecular biology. Accuracy benchmarks using all experimental data available indicate that the consensus Tm prediction errors will be within 5 ºC from the experimental value in 89% of the cases. ( Reference: A. Panjkovich et al. 2005. Nucl. Acids Res. 33: W570-W572.).

OligoCalc - an online oligonucleotide properties calculator - ( Reference: W.A. Kibbe. 2007. Nucl. Acids Res. 35(Web Server issue):W43-W46)
OligoAnalyzer 3.1 (Integrated DNA Technologies, Inc )
Mongo Oligo Mass Calculator v2.06
OligoEvaluator (Sigma -Aldrich)
Oligo Calculation Tool (Genescript, U.S.A.) - allows modification

PCR primers based upon protein sequence:

If you has the protein sequence and want the DNA sequence the best sites are Protein to DNA reverse translation or Reverse Translation part of the Sequence Manipulation Suite . If you are interested in changing a specific amino acid into another you should consult Primaclade ( Reference: Gadberry MD et al. 2005. Bioinformatics 21:1263-1264).

PCR and cloning:

AMUSER (Automated DNA Modifications with USER cloning) offers quick and easy design of PCR primers optimized for various USER cloning based DNA engineering. USER cloning is a fast and versatile method for engineering of plasmid DNA. This Web server tool automates the design of optimal PCR primers for several distinct USER cloning-based applications. It facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. ( Reference: Genee HJ et al. 2015. ACS Synth Biol. 4:342-349).

Genomic scale primers: (N.B. also see the JAVA page for additional downloadable programs)

The PCR Suite (Klinische Genetica, Erasmus MC Rotterdam, Netherlands) - this is a suite of four programs based upon Primer3 for genomic primer design. All offer considerable control on primer properties:

Overlapping_Primers - creates multiple overlapping PCR products in one sequence.
Genomic_Primers - designs primers around exons in genomic sequence. All you need is a GenBank file containing your gene.
SNP_Primers - designs primers around every SNP in a GenBank file.
cDNA_Primers - designs primers around open reading frames. Simply upload a GenBank file containing your genes.

Overlapping primer sets:

Two sites offer software is based on the Primer3 program for design overlapping PCR primer pair sets - Multiple Primer Design with Primer 3 and Overlapping Primersets

PHUSER (Primer Help for USER ) - Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. The primers have similar annealing temperature (Tm). PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer secondary structures and the presence of polyN stretches. ( Reference: Olsen LR et al. 2011. Nucl. Acids Res. 39 (Web Server issue): W61-W70)

Primerize is a Web Server for primer designs of DNA sequence PCR assembly. Primerize is optimized to reduce primer boundaries mispriming, is designed for fixed sequences of RNA problems, and passed wide and stringent tests. This efficient algorithm is suitable for extended use such as massively parallel mutagenesis library. ( Reference: Tian, S., & Das, R. (2016) Quarterly Review of Biophysics 49(e7): 1-30).

Short interfering RNA (siRNA) design:

Small interfering RNA (siRNA) guides sequence-specific degradation of the homologous mRNA, thus producing "knock-down" cells. siRNA design tool scans a target gene for candidate siRNA sequences that satisfy user-adjustable rules. A variety of servers exist:

siRNA Design Software - compares existing design tools, including those listed above. They also attempt to improve the MPI principles and existing tools by an algorithm that can filter ineffective siRNAs. The algorithm is based on some new observations on the secondary structure. ( Reference: S. M. Yiu et al. (2004) Bioinformatics 21: 144-151).

OligoWalk is an online server calculating thermodynamic features of sense-antisense hybidization. It predicts the free energy changes of oligonucleotides binding to a target RNA. It can be used to design efficient siRNA targeting a given mRNA sequence. ( Reference: Lu ZJ & Mathews DH. 2008. Nucl. Acids Res. 36: 640-647).

VIRsiRNApred - a human viral siRNA efficacy prediction server (Reference: Qureshi A et al. 2013. J Transl Med. 11:305).

Dicer-substrate siRNAs (DsiRNAs) are chemically synthesized 27-mer duplex RNAs that have increased potency in RNA interference compared to traditional siRNAs.RNAi DESIGN (IDT Integrated DNA Technologies)

pssRNAit - Designing effective and specific plant RNAi siRNAs with genome-wide off-target gene assessment.

DSIR is a tool for siRNA (19 or 21 nt) and shRNA target design. ( Reference: Vert JP et al. 2006. BMC Bioinformatics 7:520).

Imgenex siRNA retriever program has been designed to select siRNA encoding DNA oligonucleotides that can be cloned into one of the pSuppressor vectors. The input sequence can be directly accessed from a Genbank accession or sequence provided by the researcher.

siDRM is an implementation of the DRM rule sets for selecting effective siRNAs. The authors have performed an updated analysis using the disjunctive rule merging (DRM) approach on a large and diverse dataset compiled from siRecords, and implemented the resulting rule sets in siDRM, a new online siRNA design tool. siDRM also implements a few high-sensitivity rule sets and fast rule sets, links to siRecords, and uses several filters to check unwanted detrimental effects, including innate immune responses, cell toxic effects and off-target activities in selecting siRNAs. ( Reference: Gong W et al. 2008. Bioinformatics 24:2405-2406).

siMAX siRNA Design Tool (Eurofins Genomic, Germany) - is a proprietary developed software designed to help you selecting the most appropriate siRNA targeting your gene(s) of interest.

shRNA Designer (Biosettia Inc., USA) - Use this program to design shRNA oligos that are compatible with our SORT-A/B/C vectors. The design tool provides targets with the greatest chance of knocking down your gene. Please note, only one oligo is designed as it is palindromic.

siDESIGN Center (Horizon Discovery Ltd., UK) - is an advanced, user-friendly siRNA design tool, which significantly improves the likelihood of identifying functional siRNA. One-of-a-kind options are available to enhance target specificity and adapt siRNA designs for more sophisticated experimental design.

Realtime PCR primer design:

RealTimeDesign (Biosearch Technologies) - free but requires registration.

GenScript Real-time PCR (TaqMan) Primer Design - one can customize the potential PCR amplicon's size range, Tm (melting temperature) for the primers and probes, as well as the organism. You can also decide how many Primer/Probe sets you want the tool to return to you. It is possible to use a GenBank accession number as the template.

QuantPrime - is a flexible program for reliable primer design for use in larger qPCR experiments. The flexible framework is also open for simple use in other quantification applications, such as hydrolyzation probe design for qPCR and oligonucleotide probe design for quantitative in situ hybridization. ( Reference: S. Arvidsson et al. 2008. BMC Bioinformatics 9:465)

PrimerQuest - (IDT, USA)

Introduction of mutations:

WatCut (Michael Palmer, University of Waterloo, Canada) - takes an oligonucleotide and introduces silent mutations in potential restriction sites such that the amino acid sequence of the protein is unaltered.

PrimerX - can be uused to automate the design of mutagenic primers for site-directed mutagenesis. It is available in two flavours (a) Primer Design Based on DNA Sequence and (b) Primer Design Based on Protein Sequence

Primerize-2D - is designed to accelerate synthesis of large libraries of desired mutants through design and efficient organization of primers. The underlying program and graphical interface have been experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides and libraries encompassing up to 960 variants. ( Reference: Tian, S., & Das, R. (2017) Bioinformatics 33(9): 1405-1406).

When you are ready to set-up your PCR reaction see:

PCR Box Titration Calculator (Allotron Biosensor Corporation) - for figuring out the amounts of each reagent to use in a two-dimensional box titration for PCR. For standard PCR reactions adjust volume, and change "row" and "column" number to "1", click on all the "top" or "bottom" and "done". PCR Titration Calculator (Angel Herráez Cybertory: virtual molecular biology lab Universidad de Alcalá, Spain) is a similar site.

PCR Reaction Mixture Setup (R. Kalendar, University of Helsinki, Finland) - very nice site (requires Java).

PCR Optimization (Bioline, United Kingdom) - a lot of conditions

Primer presentation on the DNA sequence:

Sequence Extractor (Paul Stothard) - generates a clickable restriction map and PCR primer map of a DNA sequence (accepted formats are: raw, GenBank, EMBL, and FASTA) offering a great deal of control on output. Protein translations and intron/exon boundaries are also shown. Use Sequence Extractor to build DNA constructs in silico.


Loop-Mediated Isothermal Amplification

Loop-mediated isothermal amplification (LAMP) uses 4-6 primers recognizing 6-8 distinct regions of target DNA for a highly specific amplification reaction. A strand-displacing DNA polymerase initiates synthesis and 2 specially designed primers form &ldquoloop&rdquo structures to facilitate subsequent rounds of amplification through extension on the loops and additional annealing of primers. DNA products are very long (>20 kb) and formed from numerous repeats of the short (80&ndash250 bp) target sequence, connected with single-stranded loop regions in long concatamers. These products are not typically appropriate for downstream manipulation, but target amplification is so extensive that numerous modes of detection are possible. Real-time fluorescence detection using intercalators or probes, lateral flow and agarose gel detection are all directly compatible with LAMP reactions. Instrumentation for LAMP typically requires consistent heating to the desired reaction temperature and, where needed, real-time fluorescence for quantitative measurements. Optimized settings for running LAMP experiments on isothermal instruments can be found here.

Reaction Temperature Amplicon Size Detection Method(s)
65°C <250 nt Visual, Lateral flow, Gel, Turbidity

Loop-mediated isothermal amplification (LAMP) uses 4-6 primers recognizing 6-8 distinct regions of target DNA. A strand-displacing DNA polymerase initiates synthesis and 2 of the primers form loop structures to facilitate subsequent rounds of amplification.

In addition to the more traditional or complex detection methods, LAMP is so prolific that the products and byproducts of these reactions can also be visualized by eye. For example, magnesium pyrophosphate produced during the reaction can be observed as a white precipitate or added indicators like calcein or hydroxynaphthol blue can be used to signal a positive reaction. Alternatively, using the 2X Colorimetric LAMP Master Mix developed by NEB enables a strong color change from pink to yellow based on a pH change during the reaction. An updated version of this product has been formulated with dUTP and UDG to be compatible with carryover prevention between amplification rounds &ndash WarmStart Colorimetric LAMP 2X Master Mix with UDG. The colorimetric detection technology is a key component of the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit, which can be used in the analysis of SARS-CoV-2, the novel coronavirus that causes COVID-19.

Designing LAMP primers can be challenging, but software tools greatly facilitate this process. We suggest using the NEB LAMP Primer Design Tool to design LAMP primers. After inputting a DNA or RNA sequence of interest, the LAMP Primer Design tool will identify suitable target regions and create the outer F3/B3 and looping inner FIP/BIP primers in a single step. The LoopF/LoopB primers, that accelerate the LAMP reaction, are created in a second step and are strongly recommended for best performance.

LAMP is well-suited for point-of-care and field diagnostics and LAMP assays have been designed for the detection of a wide range of RNA and DNA targets from all manner of sample types. Examples include tests for:

The LAMP reaction is robust and tolerant of inhibitors, allowing for crude sample prep and minimal nucleic acid purification if desired. WarmStart ® RTx and Bst 2.0 WarmStart were developed for optimal performance in LAMP/RT-LAMP and are combined in convenient LAMP Master Mixes to simplify assay design.