Information

4.11.4: Attachment and Entry of Herpes Simplex - Biology

4.11.4: Attachment and Entry of Herpes Simplex - Biology


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Herpes simplex virus attaches to a host’s cells with viral envelope glycoproteins, which then allows entry of the viral capsid into the host cell.

Learning Objectives

  • Illustrate HSV attachment to host cells

Key Points

  • The genome encodes for 11 different glycoproteins, four of which, gB, gC, gD and gH, are involved in viral attachment.
  • The sequential stages of HSV entry are analogous to those of other viruses.
  • First, complementary viral and cell surface receptors bring the viral and host cell membranes into close proximity. Next, the two membranes begin to merge, forming a hemifusion state. Finally, a stable entry pore is formed through which the viral envelope contents are introduced to the host cell.

Key Terms

  • glycoprotein: A protein with covalently bonded carbohydrates.
  • hemifusion: Partial fusion, or the first stage in full fusion.
  • heparan sulfate: A polysaccharide found, associated with protein, in all animal tissue; it has a regulatory function in several biological activities.

Herpes simplex viruses 1 and 2 (HSV-1 and HSV-2) are two members of the herpes virus family, Herpesviridae, that infect humans. Both HSV-1 (which produces most cold sores) and HSV-2 (which produces most genital herpes) are ubiquitous and contagious. They can be spread when an infected person is producing and shedding the virus.

The sequential stages of HSV entry are analogous to those of other viruses. At first, complementary receptors on the virus and the cell surface bring the viral and cell membranes into close proximity. In an intermediate state, the two membranes begin to merge, forming a hemifusion state. Finally, a stable entry pore is formed through which the viral envelope contents are introduced to the host cell.

The genome encodes for 11 different glycoproteins, four of which, gB, gC, gD and gH, are involved in viral attachment. Initial interactions occur when viral envelope glycoprotein C (gC) binds to a cell surface particle called heparan sulfate. A second glycoprotein, glycoprotein D (gD), binds specifically to at least one of three known entry receptors. These include herpesvirus entry mediator (HVEM), nectin-1 and 3-O sulfated heparan sulfate. The receptor provides a strong, fixed attachment to the host cell. These interactions bring the membrane surfaces into mutual proximity and allow for other glycoproteins embedded in the viral envelope to interact with other cell surface molecules. Once bound to the HVEM, gD changes its conformation and interacts with viral glycoproteins H (gH) and L (gL), which form a complex. The interaction of these membrane proteins results in the hemifusion state. Afterward, gB interaction with the gH/gL complex creates an entry pore for the viral capsid. Glycoprotein B interacts with glycosaminoglycans on the surface of the host cell.


Herpes simplex virus

Herpes simplex virus 1 and 2 (HSV-1 and HSV-2), also known by their taxonomical names Human alphaherpesvirus 1 and Human alphaherpesvirus 2, are two members of the human Herpesviridae family, a set of new viruses that produce viral infections in the majority of humans. [1] [2] Both HSV-1 (which produces most cold sores) and HSV-2 (which produces most genital herpes) are common and contagious. They can be spread when an infected person begins shedding the virus.

All other Simplexvirus spp.:

  • Ateline alphaherpesvirus 1
  • Bovine alphaherpesvirus 2
  • Cercopithecine alphaherpesvirus 2
  • Leporid alphaherpesvirus 4
  • Macacine alphaherpesvirus 1
  • Macropodid alphaherpesvirus 1
  • Macropodid alphaherpesvirus 2
  • Panine alphaherpesvirus 3
  • Papiine alphaherpesvirus 2
  • Pteropodid alphaherpesvirus 1
  • Saimiriine alphaherpesrus 1

About 67% of the world population under the age of 50 has HSV-1. [3] In the United States, about 47.8% and 11.9% are believed to have HSV-1 and HSV-2, respectively. [4] Because it can be transmitted through any intimate contact, it is one of the most common sexually transmitted infections. [5]


Abstract

Herpes simplex virus type 2 (HSV-2) is transmitted through the genital mucosa during sexual encounters. In recent years, HSV-1 has also become commonly associated with primary genital herpes. The mechanism of viral entry of HSV-1 and HSV-2 in the female genital tract is unknown. In order to understand the molecular interactions required for HSV entry into the vaginal epithelium, we examined the expression of herpesvirus entry mediator nectin-1 in the vagina of human and mouse at different stages of their hormonal cycle. Nectin-1 was highly expressed in the epithelium of human vagina throughout the menstrual cycle, whereas the mouse vaginal epithelium expressed nectin-1 only during the stages of the estrous cycle in which mice are susceptible to vaginal HSV infection. Furthermore, the ability of nectin-1 to mediate viral entry following intravaginal inoculation was examined in a mouse model of genital herpes. Vaginal infection with either HSV-1 or HSV-2 was blocked by preincubation of the virus with soluble recombinant nectin-1. Viral entry through the vaginal mucosa was also inhibited by preincubation of HSV-2 with antibody against gD. Together, these results suggest the importance of nectin-1 in mediating viral entry for both HSV-1 and HSV-2 in the genital mucosa in female hosts.

Understanding the entry events of herpes simplex virus type 2 (HSV-2) at the genital mucosa is important in the development of preventative measures, such as topical microbicides, to stop its spread through sexual transmission. Although HSV-1 is classically associated with oral infection, an alarming increase in HSV-1 has been observed in association with primary genital herpes in recent years (14). The in vivo mechanism of viral entry in the female genital tract of HSV-1 and HSV-2 is unknown.

The molecular mechanisms of virus attachment and entry have been a focus of intense investigations, especially for HSV-1 but also for HSV-2 (reviewed in reference 30). Currently, the model for HSV entry begins with the attachment of the virus to a target cell through binding of HSV glycoprotein C (gC) and/or gB to the cell surface heparan sulfate proteoglycans (reviewed in reference 28). Subsequently, the attached virus can begin its entry through interaction between gD and a variety of unrelated cell surface receptors, including the herpesvirus entry mediator A (HveA) (21), a member of the tumor necrosis factor receptor family, HveB (nectin-2) (33) and HveC (nectin-1) (4), both members of the immunoglobulin superfamily, and 3-O-sulfated heparan sulfate (27).

Owing to its limited expression in lymphocytes and monocytes (13), HveA has been shown to mediate HSV entry into human activated T lymphocytes (21). Whether HveA participates in viral entry through genital epithelial cells is unknown. Human HveB mediates the entry of HSV-2 and certain mutant strains of HSV-1 but fails to mediate entry of wild-type HSV-1 (33). Furthermore, evidence indicates that the mouse homologue of HveB fails to mediate entry of either HSV-1 or HSV-2 (16). In contrast, nectin-1 has been known for its potent ability to mediate entry of both HSV-1 and HSV-2 and has been shown to be expressed in a variety of cells, including epithelial cells and neuronal cells (4, 17, 25, 26), making this molecule a prime candidate receptor for HSV-1 and HSV-2 entry at the mucosal epithelium.

Nectin-1 is a member of the nectin family, which localizes at the adherens junctions of epithelial cells and functions as a cell adhesion molecule (31, 32). While in vitro studies support the notion that the binding of gD to a cell surface receptor is necessary for virus entry (4, 8, 15, 21), it is not clear which receptor(s) mediates the entry of HSV-1 and HSV-2 in vivo at the natural sites of virus transmission. Furthermore, although nectin-1 expression has been demonstrated in the rodent epidermis and vaginal epithelium with a rabbit polyclonal antibody (17, 26), the expression of nectin-1 in the vaginal mucosa with respect to the localization and function, particularly with respect to the hormonal cycle, is not clear.

In a mouse model of HSV-2 vaginal infection with the thymidine kinase (TK) mutant strain of HSV-2, susceptibility to the virus occurs primarily during the diestrous and proestrous phases of the estrous cycle (3, 23). However, how susceptibility is influenced by the hormonal changes in the female host is unknown. The susceptible stages are represented by a characteristically thinned epithelium, consisting of five to seven cell layers, which can also be induced and maintained by treatment with progesterone derivatives such as depo-medroxyprogesterone acetate. One potential mechanism relates to the thickness and the permeability of the vaginal epithelial layer. With the increase in serum estrogen levels, the epithelial cell layer thickens during the estrous stage. Following ovulation, with the decrease in the estrogen and increase in the progesterone levels, the superficial layers of the vaginal epithelium are delaminated during the metestrous phase, and by the diestrous phase, the epithelial layer becomes maximally thin and most permeable to luminal proteins (24).

However, this hypothesis was challenged by a recent study in which a dissociation in the correlation between the thickness of the vaginal epithelium and the susceptibility to HSV-2 infection was demonstrated by treatment of mice with different forms of progesterone (10). Kaushic et al. demonstrated that depo-medroxyprogesterone acetate treatment of mice resulted in a 100-fold increase in susceptibility to genital HSV-2 compared to untreated mice at diestrous phase. Furthermore, long-term effects of depo-medroxyprogesterone acetate treatment included reduction in protective immunity to HSV-2 (10). Thus, the thickness and gross morphology of the vaginal epithelium alone cannot account for the susceptibility to HSV-2 infection.

Another potential basis for hormonal regulation of susceptibly to HSV-2 genital infection is the expression of receptor on the mucosal epithelial cell surface. Because vaginal epithelium is continually undergoing regenerative changes, cellular expression of the viral entry molecules may also vary depending on the hormonal status of the host. The difference in location and/or intensity of receptor expression may account for the variability in incidence of intravaginal HSV-2 infection throughout the sex hormone cycle. Although correlation between the phases of the menstrual cycle and susceptibility to HSV-2 infection has not been examined in humans, cervical shedding of HSV was significantly associated with oral contraception and depo-medroxyprogesterone acetate use (22).

In this study, we examined the expression of nectin-1 in human and murine vaginal tissues at various stages of the menstrual and estrous cycles, respectively. Nectin-1 is conserved between humans and mice with 95% sequence identity at the amino acid level (20, 26), and both species' forms have the broadest range of herpesviruses for they mediate entry of HSV-1, HSV-2, porcine pseudorabies virus, and bovine herpesvirus-1 in vitro (19, 26). Here, we demonstrate that human vaginal epithelium expresses nectin-1 at all stages of the menstrual cycle. In contrast, nectin-1 is expressed on the superficial epithelial cells of the mouse vagina at the susceptible diestrous and proestrous phases of the estrous cycle. Furthermore, using soluble nectin-1 to block viral binding to its host receptor(s), we demonstrate the requirement for the availability of the nectin-1 binding site in establishing in vivo infection through the vaginal mucosa. The in vivo importance of gD in the establishment of replication in the vaginal tract is revealed through blockage of gD with a highly specific antibody. The results presented in this study demonstrate both the phenotypic and functional relevance of nectin-1 in mediating entry of both HSV-1 and HSV-2 into the vaginal epithelium in vivo and suggest the importance of nectin-1 in genital transmission of HSV in women.


MATERIALS AND METHODS

Viruses.

HSV-1 KOS and KOStk12 were grown and titers were determined on Vero cells, and the viruses were purified as described previously (24, 42). The KOStk12 and gD-null KOSgDβ viruses were obtained from P. G. Spear (17). Noncomplemented KOSgDβ was produced in Vero cells, and complemented viruses were produced and titers were determined on VD60 cells (17, 35). Partial purification of KOSgDβ was done as described by Stiles et al. (66). Equivalent amounts of capsid were present in supernatant for the virus produced in VD60 cells and that for the virus produced in Vero cells as determined by Western blotting with antibody (Ab) NC-1.

Anti-HVEM monoclonal Ab (MAb) CW10 and polyclonal Ab (PAb) R140 were described previously (69, 76). For fluorescence-activated cell sorting (FACS), CW10 was directly coupled with phycoerythrin (PE) at Molecular Probes/Invitrogen. Anti-BTLA MAb MIH26 was purchased from eBiosciences and anti-LIGHT MAb 115520 from Rɭ Systems. Anti-CD160 MAbs 5D.8E10 and 5D.10A11 were the generous gift of Gordon Freeman (Dana Farber Research Institute). Secondary anti-IgG antibodies coupled with PE or Alexa 488 were purchased from Molecular Probes/Invitrogen, and those coupled to horseradish peroxidase (HRP) were purchased from KPL.

Cell lines. (i) Culture conditions.

Murine melanoma B78H1 cells were grown in Dulbecco's modified Eagle's medium (DMEM) with 5% fetal calf serum (FCS) and penicillin-streptomycin (P-S). The previously described transfected B78H1 cell lines B78H1-control-16 (abbreviated B78 here), B78H1-HVEM, B78H1-HVEM-Y23A, B78H1-gD(wt), and B78H1-gD(W294A) were grown in the same medium supplemented with 500 μg/ml G418 (15, 40, 66). 293T cells were maintained in DMEM with 10% FCS and P-S. CHOK1 cells were maintained in Ham's F-12 medium with 10% FCS and P-S. CHO-nectin-1 (clone R3A) and CHO-HVEM (clone A12) were maintained in the same medium with 250 μg/ml G418 (16, 42). CHO-CD160 cells (a gift from G. Freeman, Dana Farber Research Institute) were maintained in the same medium with 300 μg/ml hygromycin B (1). Sf9 (Spodoptera frugiperda) cells, used for producing recombinant baculoviruses and recombinant glycoproteins, were propagated in Sf900II medium (GIBCO) (78). Human primary T cells (CD3 + CD14 − CD11b − CD16 − ) were obtained from the Human Immunology Core of the University of Pennsylvania. Fresh resting cells were used immediately for FACS or cocultures without activation.

(ii) B78-gD(D30A) cell line.

B78H1 cells were transfected with plasmid pDL449 to express gD(D30A) (14). Selection of the cell line and determination of gD expression were done as described by Stiles et al. (66). The clonal cell line used in this study is B78H1-gD(D30A) no. 26.

(iii) Cell lines expressing BTLA and LIGHT.

The full-length open reading frame of human BTLA with flanking 5′ KpnI and 3′ XhoI sites for cloning were synthesized at Blue Heron Biotechnology. cDNA obtained from Blue Heron was digested with KpnI and XhoI and ligated into pcDNA3.1/hygro to make plasmid pKS846 for BTLA. The open reading frame of LIGHT was subcloned using BamHI and XhoI from plasmid pLIGHT (a gift from M. Lazaro and H. Ertl, Wistar Institute) into pcDNA3.1/hygro to generate plasmid pKS892. 293T cells were transfected with plasmids pKS846 (BTLA), pKS892 (LIGHT), and pcDNA3.1/hygro (for control) using Lipofectamine according to the manufacturer's instructions. Clonal cell lines were selected by limiting dilution in the presence of 250 μg/ml hygromycin B and further maintained in DMEM with 10% FCS, antibiotics, and 200 μg/ml hygromycin B. Clones were selected by FACS for the level of surface expression of BTLA using MAb MIH26 (eBiosciences) or of LIGHT using MAb α-LIGHT 115520 (Rɭ Systems). The clonal cell lines used in this study are 293T-BTLA no. 3, 293T-LIGHT no. 2, and 293T-control no. 1.

Baculovirus recombinants. (i) Construction of plasmids. (a) BTLA.

A 375-bp fragment of BTLA corresponding to amino acids 32 to 157 was PCR amplified from plasmid pKS846. Amino acid 32 is the first amino acid after the predicted signal peptide, and amino acid 157 is the last one before the predicted transmembrane region. Primers used were forward primer bac-hBTLA-F (5′-GCGGATCCAGAATCATGTGATGTACAGCTTTAT), which adds an upstream BamHI site, and reverse primer bac-hBTLA-R (5′-CGGCTGCAGTTAATGGTGATGATGGTGATGACTATACAGGAGCCAGGGTCT), which adds six histidine residues after amino acid 157 of BTLA, a stop codon, and a downstream PstI site. The PCR product was digested with BamHI and PstI and ligated into pVTBac (70) to create plasmid pKS779. This plasmid was recombined into baculovirus by cotransfecting with Baculogold DNA (BD Biosciences) (63). Baculovirus recombinants expressing BTLA were subjected to two rounds of plaque purification. The recombinant baculovirus was named bac-hBTLA(157t), and the recombinant protein was designated BTLA(157t) or BTLAt.

(b) LIGHT.

A 540-bp PCR fragment encoding amino acids 60 to 240 was PCR amplified from plasmid pLIGHT (a gift from M. Lazaro and H. Ertl, Wistar Institute) using forward primer bac-LIGHT-F (5′-GCGGATCCACATCACCATCACCATCACCAGCTGCACTGGCGTCTAGGAGAG), which adds a BamHI site and six histidine residues prior to amino acid 60 of LIGHT, and reverse primer bac-LIGHT-R (5′-GCGGAATTCTCACACCATGAAAGCCCCGAAGTAAGA), which adds a stop codon and a downstream EcoRI site. Since LIGHT is a type II membrane protein, amino acid 60 is the first amino acid after the transmembrane sequence in the ectodomain and amino acid 240 is the last amino acid of the protein. The PCR product was digested with BamHI and EcoRI and ligated into pVTBac to make plasmid pKS918. This plasmid was used to make baculovirus bac-LIGHT(t60). The recombinant protein was designated LIGHT(t60) or LIGHTt.

(c) CD160.

The sequence corresponding to amino acids 27 to 136 of CD160 with an additional six histidine residues after amino acid 136 was synthesized at Blue Heron Biotechnology. The sequence included an upstream BamHI site and a downstream EcoRI site for cloning. The DNA was digested with BamHI and EcoRI and ligated into pVTBac to generate plasmid pKS916. This plasmid was used to make baculovirus bac-CD160(136t). The recombinant protein was designated CD160(136t) or CD160t.

The sequence corresponding to amino acids 35 to 205 of lymphotoxin α with six histidine residues after amino acid 205 was synthesized at Blue Heron Biotechnology. Since LTα is normally a secreted protein, no truncation was necessary. Additionally, the sequence included an upstream BamHI site and a downstream EcoRI site. The DNA was digested with BamHI and EcoRI and ligated into pVTBac to create plasmid pKS917. This plasmid was used to make baculovirus bac-LTα. The recombinant protein was designated LTα(r).

(ii) Purification of recombinant proteins. (a) BTLAt and LTα(r).

Sf9 cells grown in a 1-liter suspension culture were infected with recombinant baculovirus (multiplicity of infection [MOI] = 4) for 48 h. The clarified supernatant was concentrated, exchanged into phosphate-buffered saline (PBS) by tangential flow filtration (10-kDa-molecular-mass cutoff membrane Millipore), and incubated overnight with 2.5 ml of nickel-nitriloacetic acid resin (Qiagen) at 4ଌ. The resin was washed first with PBS and then with stepwise-increasing concentrations of imidazole (0.01 to 0.25 M) in 0.02 M phosphate buffer (pH 7.5) containing 0.5 M NaCl. The 0.25 M imidazole fraction, containing the purest recombinant protein, was dialyzed against PBS and concentrated (10-kDa-molecular-mass cutoff centrifugal membrane Millipore). The yields of purified BTLAt and LTα(r) were 2 mg/liter of supernatant.

(b) LIGHTt and CD160t.

The purification of LIGHTt and CD160t was done using the protocol described above with the following modifications. These proteins were purified for 4 h at 4ଌ using only 0.5 ml of nickel-nitriloacetic acid resin in the presence of 5 mM imidazole. The 0.1 M and 0.25 M fractions, which contained most of the pure proteins, were combined before dialysis against PBS and concentrated (5-kDa-molecular-mass cutoff centrifugal membrane). These modifications improved the purities of LIGHTt and CD160t but did not improve their yields, which remained low. The yields of purified LIGHTt and CD160t were 2 and 20 μg/liter of supernatant, respectively.

(c) HVEMt-Y23A.

The expression plasmid for HVEM(200t)-Y23A was derived using QuikChange mutagenesis of plasmid pCW275 (77) with forward primer pmr-HveA-Y23A-F (5′-CAAGTGCAGTCCAGGTGCTCGTGTGAAAGGAGGC) and reverse primer pmr-HveA-Y23A-R (5′-GCCTCCTTCACACGAGCACCTGGACTGCACTTG). The resulting plasmid was named pKS919. Recombinant baculovirus bac-HVEM(200t)-Y23A was made using the methods described above for BTLA. The recombinant protein was designated HVEM(200t)-Y23A or HVEMt-Y23A and was purified using the protocol previously described for HVEM(200t) (76). The yield of purified HVEMt-Y23A was 1.5 mg/liter of supernatant.

Gel filtration analysis of molecular weight.

Dextran blue was used to determine the void volume of a Superdex 200 column (GE Healthcare Life Sciences), which was calibrated with high- and low-molecular-weight standards using PBS as the running buffer. Two hundred microliters of concentrated LIGHTt, LTα(r), BTLAt, and CD160t was loaded independently. The molecular weights of the eluted proteins were calculated from a standard plot according to the molecular weight standards.

FACS analysis of cell cocultures.

Target cells expressing HVEM were detached with trypsin and then counted and divided in aliquots for labeling with Qdots using the Qtracker 655 labeling kit (Quantum Dot Corp/Invitrogen, Hayward CA) for 1 h at 37ଌ in DMEM supplemented with 5% FCS according to the manufacturer's instructions. Qdot labeling was done to identify target cells during FACS analysis (66). Target cells were washed three times with culture medium and mixed with twice as many unlabeled effector cells. A total of 0.75 × 10 6 cells were plated in each well of a 12-well plate and cultivated overnight in DMEM supplemented with 5% FCS and antibiotics. Target and effector cells were also cultivated separately as controls. For FACS analysis, cells were detached with EDTA (Versene) and resuspended in cold PBS containing 3% FCS (PBS-FCS). Labeling with anti-HVEM MAb CW10-PE was performed on 0.5 × 10 6 cells (50 μl) for 30 min on ice. Cells were washed with cold PBS-FCS and fixed with 3% paraformaldehyde (PFA) in PBS with 3% FCS. In order to gate target cells during FACS analysis, Qtracker655 was detected by excitation at 630 nm and reading at 660 ± 15 nm. Qtracker655-positive target cells were positively selected for measurement of PE fluorescence for HVEM detection.

FACS analysis of downregulation during virus infection.

A total of 0.75 × 10 6 B78-HVEM cells were seeded in 12-well plates in DMEM with 5% FCS and antibiotics and allowed to attach 4 h at 37ଌ. The medium was removed, and virus was added in 1 ml chilled medium and allowed to bind for 45 min at 4ଌ. The cells were then shifted to 37ଌ for 30 min. Cells were detached with EDTA and resuspended in cold PBS-FCS. B78-HVEM cells were stained with anti-HVEM MAb CW10-PE (20 μg/ml) in 50 μl PBS-FCS. Cells were then washed and fixed in 3% PFA in PBS with 3% FCS.

Determination of binding of HVEMt to CHO-CD160 cells by cell-based enzyme-linked immunosorbent assay (CELISA).

HVEMt was diluted in Ham's F-12 medium with 10% FCS, added to 4 × 10 4 CHO-CD160 or CHO cells in 96-well plates, and incubated for 1 h at 4ଌ. Cells were washed three times with PBS and fixed with 100 μl 3% paraformaldehyde in PBS at room temperature (RT) for 60 min. Cells were washed twice, and anti-HVEM PAb R140 (3 μg/ml) was added in Ham's F-12 medium with 10% FCS and left for 1 h at RT. Cells were washed as before and incubated with anti-rabbit IgG coupled to HRP (2 μg/ml) for 1 h. Cells were washed with 20 mM citrate buffer (pH 4.5) before the addition of substrate [2,29-azinobis(3-ethylbenzthiazolinesulfonic acid) (ABTS)] (Moss Inc.). Absorbance at 405 nm was read on a microtiter plate reader (Bio-Tek).

SPR experiments. (i) Kinetics and affinity measurements.

Surface plasmon resonance (SPR) experiments were carried out on a Biacore 3000 optical biosensor (Biacore Life Sciences) at 25ଌ. The running buffer for the experiments was HBS-EP (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.005% polysorbate 20). HVEMt was coupled to a CM5 sensor chip through primary amine groups. The flow cells were activated with 1-ethyl-3-(3-dimethylamino-propyl)carbodiimide hydrochloride and N-hydroxysuccinimide (EDC-NHS). HVEMt (0.05 mg/ml) in 10 mM sodium acetate (NaAc) (pH 4.5) was injected until an amount corresponding to approximately 2,000 response units (RU) was coupled to flow cell 2 (Fc2). The surface was quenched by injection of 1 M ethanolamine-HCl (pH 8.5). The Fc1 control surface was activated and quenched without the addition of protein.

To measure affinities, 2-fold serial dilutions of each ligand were injected across Fc1 and Fc2 at 50 μl/min. Ligand-HVEM association was allowed to occur for 2 min, with the wash delay set for an additional 2 min to allow for a smooth dissociation curve. The chip surface was regenerated by injecting brief pulses of 0.2 M Na2CO3 (pH 10) until the response signal returned to baseline. SPR data were analyzed with BIAevaluation software version 4.1, which employs global curve-fitting analysis. Sensorgrams were corrected for nonspecific binding by subtracting the control sensorgram (Fc1) from the HVEMt surface sensorgram (Fc2). Model curve fitting was done with a 1:1 Langmuir binding model with a drifting baseline. This is the simplest model for the interaction between receptor and ligand it follows the equation A + B ⇆ AB. The rate of association (kon) is measured from the forward reaction, while the rate of dissociation (koff) is measured from the reverse reaction. The binding affinity (KD) is koff/kon. In each case, the chi-square (χ 2 ) value for goodness of fit was less than 1 and the residuals were within ଓ RU, indicating that the data were a good fit to the binding model.

BTLAt binding to HVEMt could not be analyzed using the global curve-fitting analysis because the rates of association and dissociation were too high. Therefore, various concentrations of BTLAt were injected to equilibrium for measurement of affinity (KD) by Scatchard analysis. Equilibrium binding was reached within 2 min, and thus the amount of binding (RU) at 2 min was used for Scatchard analysis. For each concentration, RU bound versus RU bound/concentration was plotted and fitted to a linear model. The negative inverse of the slope of the line is equal to the KD.

(ii) Competition between two ligands.

Each HVEM ligand (acting as ligand 1) was covalently coupled to the surface of a CM5 sensor chip through primary amines as described above. The coinject function was used to inject 300 to 400 RU of HVEMt immediately followed by the test ligand (acting as ligand 2). To regenerate the sensor chip surface, brief pulses of 0.2 M Na2CO3 (pH 9) were injected as necessary until the response signal returned to baseline. This process was repeated for each of the ligands. All ligands were able to block themselves using this method.

(iii) Binding of HVEMt-Y23A.

Each ligand was coupled to a CM5 sensor chip using primary amines as described above. HVEMt or HVEMt-Y23A was flowed across the chip at 5 μl/min for 4 min. The amount of binding at the end of the injection was recorded. The sensor chip surface was regenerated with brief pulses of 0.2 M Na2CO3 (pH 10) until the signal returned to baseline.

(iv) Competition by anti-HVEM MAbs.

MAb CW3, CW7, CW10, CW12, or CW13 was coupled to the surface of a CM5 sensor as described above. Coinjection of HVEMt followed by the test ligand was performed as described above for competition between two ligands. The sensor chip was regenerated with 0.2 M Na2CO3 (pH 11) until the response returned to baseline.

Blocking of virus entry with HVEM ligands.

CHO-HVEM, CHO-nectin-1, or B78-HVEM cells were preincubated with gD(306t), gD(285t), BTLAt, or LTα(r) diluted in culture medium (50 μl/well) for 1 h at 4ଌ. An equal volume of culture medium containing purified KOStk12 virus (MOI = 5) was added, and cells were placed at 37ଌ for 6 h. β-Galactosidase activity was used to monitor HSV entry. The results were plotted as percentages of values for controls where no ligand was added.


Glycoprotein D Receptor-Dependent, Low-pH-Independent Endocytic Entry of Herpes Simplex Virus Type 1

FIG. 1 . gD receptor-dependent protection of glycoprotein B from BS3 cross-linking during virus entry. A. Virus was attached to C10 cells at 4°C. Entry was then initiated by incubation at 37°C for the indicated times and then stopped by placing the cells on ice. Cells were then cross-linked with BS3 or mock treated and then lysed. gB was detected by immunoprecipitation with MAb BD60 and then Western blotting with polyclonal antibody R69. B. The cross-linking assay was carried out on C10 cells or receptor-negative B78 cells. After virus attachment, samples were held at 4°C (lanes 1, 2, 5, and 6) or placed at 37°C for 10 min (lanes 3, 4, 7, and 8) and then chilled on ice. Samples were then cross-linked with BS3 (lanes 1, 3, 5, and 7) or mock treated (lanes 2, 4, 6, and 8). C. The assay was carried out using virus that was pretreated with the indicated gD-specific MAb. MAb-treated virus was also titrated on Vero cells to measure the degree of neutralization. Titers (log10 PFU/ml) are shown below the panel. Open arrows indicate high-molecular-weight gB-containing complexes formed by cross-linking. Solid arrows point to unit-length gB. nv, no virus. FIG. 2 . Protection of gB from cross-linking occurs with kinetics comparable to the rate of virus entry. A. Rate of virus entry into C10 cells at 37°C, 30°C, and 22°C. A standard acid inactivation entry assay was carried out (see Materials and Methods). B. After attachment of virus to C10 cells at 4°C, entry was initiated by incubation at the indicated temperatures for the indicated times. Cross-linking was then carried out as before. For clarity, only the unit-length gB band is shown. nx, no cross-linking nv, no virus. FIG. 3 . Rapid, gD receptor-dependent protection of viral glycoproteins from proteinase K digestion. A. Virus was attached to B78 and C10 cells for 45 min at 4°C. Entry was then initiated by incubation at 37°C for the indicated times. Cells were treated with proteinase K, and gB was detected by immunoprecipitation and Western blotting. B. C10 cells were infected with HSV gD-GFP virus as for panel A. Samples were proteinase K treated and then lysed. gD-GFP was immunoprecipitated with MAb DL6 and detected by Western blotting with polyclonal antibody R7. nv, no virus. C. Virus was attached to B78 (lanes 1, 2, 5, and 6) or C10 (lanes 3, 4, 7, and 8) cells for 45 min at 4°C. Cells were then incubated at 37°C for 10 min (lanes 2, 4, 6, and 8) or held at 4°C (lanes 1, 3, 5, and 7), treated with proteinase K or mock treated for 1 h at 4°C, and lysed in the presence of PMSF, and glycoproteins were detected by immunoprecipitation and Western blotting. FIG. 4 . Protection of viral gB from proteinase K correlates with endocytic entry. After virus attachment for 45 min at 4°C, cells were either held at 4°C (lanes 1 and 3) or incubated at 37°C for 10 min (lanes 2 and 4) and then chilled on ice. Cells were then digested (lanes 3 and 4) or mock treated (lanes 1 and 2) with proteinase K and lysed in the presence of PMSF. gB was immunoprecipitated from the lysates and detected by Western blotting. FIG. 5 . Energy dependence of HSV entry into C10 cells. C10 cells were treated with energy depletion medium, and then the effect on virus entry was determined using a GFP reporter virus. The number of infected, GFP-expressing cells in the mock-treated sample was set to 100%. FIG. 6 . EM analysis of HSV localization on C10 and B78 cells. The localization of HSV on C10 cells (A to F) and B78 cells (G and H) was examined by EM after virus attachment at 4°C (A to C, G, and H) or after initiation of entry by incubation at 37°C for 4 (D and F) or 10 min (E). Original magnification: ×25,000 (A) ×100,000 (B, C, and F) ×50,000 (D, E, G, and H). Bars, 100 nm. FIG. 7 . Entry of HSV into C10 cells is not affected by bafilomycin A1 or ammonium chloride. C10 cells were treated with the indicated concentrations of bafilomycin A1 (A) or ammonium chloride (B) for 1 h. Virus was added in the presence of fresh inhibitor. After 90 min the cells were refed with medium containing the inhibitor. After a further 4 h, the inhibitor was washed away and a semisolid overlay was added. Plaques were counted at 24 h (for VSV) or 48 h (for HSV) postinfection. FIG. 8 . Model of entry pathways. The figure depicts four pathways by which HSV can enter cells. Pathways A, C, and E result in viral gene expression, and pathway B does not. However, all four pathways are rapid and specific. A. Vero cells: receptor-dependent fusion between virus envelope and plasma membrane. B. CHO K1 cells: gD receptor-independent endocytic internalization of virions leading to degradation of virions. C. CHO nectin-1 cells: involvement of gD receptor in virus internalization is unknown. Acidification is required for successful egress of virions from endosome. D. B78 cells: no rapid internalization. Virions remain on the cell surface and are peripherally attached, without any cell surface alterations at point of contact. (Note that, by EM, virions remain on the surface of B78 cells after 10 min of incubation at 37°C and that no protection of viral glycoproteins from cross-linker is seen on these cells for as long as 30 min at 37°C. However, the ultimate fate of these cell surface virions is unknown.) E. C10 cells: gD receptor-dependent internalization preceded by enwrapment of virions by plasma membrane invaginations. Release of virions from endocytic vesicle does not require endosome acidification.

Abstract

Herpesviruses are double-stranded DNA, enveloped viruses that infect host cells through fusion with either the host cell plasma membrane or endocytic vesicle membranes. Efficient infection of host cells by herpesviruses is remarkably more complex than infection by other viruses, as it requires the concerted effort of multiple glycoproteins and involves multiple host receptors. The structures of the major viral glycoproteins and a number of host receptors involved in the entry of the prototypical herpesviruses, the herpes simplex viruses (HSVs) and Epstein–Barr virus (EBV), are now known. These structural studies have accelerated our understanding of HSV and EBV binding and fusion by revealing the conformational changes that occur on virus–receptor binding, depicting potential sites of functional protein and lipid interactions, and identifying the probable viral fusogen.


Role of AT and Other Heparin-Binding Proteins in Vascular Biology

HS is biosynthesized as a proteoglycan through the same pathway as heparin 89 however, unlike heparin, the HS GAG chain remains connected to its core protein. Heparin is localized to the granules of mast cells and is only released locally in the allergic response. HSPG is extracellular, residing in the ECM and on the surface of all animal cells. 90 The vessel wall is composed of a monolayer of endothelial cells (ECs) below which lie SMCs. Both ECs and SMCs contain membrane-associated HSPGs. 91,92 HS on the endothelium is known to contain AT-binding sites. 91 Interestingly, knockout mice, missing 3-OST-1 responsible for placement of the critical 3-O-sulfo group in the AT-binding pentasaccharide, do not show an abnormal coagulation phenotype. 93 There are several possible explanations for the failure to observe this phenotype. First, AT interaction with 3-O-sulfo group containing HS might not be critical for homeostasis. This is unlikely because AT requires 3-O-sulfo group for tight binding, and AT deficiencies or mutations result in coagulation abnormalities. Second, overexpression of AT or alternative anticoagulant mechanisms might compensate for the loss of 3-O-sulfo group in HS. Third, another 3-OST isoform, such as 3-OST-5, which can synthesize the same sequence, might replace the lost function of 3-OST-1. 94 Although the issue remains to be solved, it appears that the final explanation is the most plausible.

HSPGs play a complex role in the ECM, regulating a wide variety of biological processes, including coagulation, inflammation, angiogenesis, growth factors, cell adhesion, and others. In vascular biology, blood coagulation is triggered through enzymatically governed proteolytic processes. The reaction principally consists of a successive activation of proenzymes to proteolytic enzymes. Among them, thrombin is the key protease in coagulation. This clotting enzyme not only exhibits coagulant activities such as fibrinogen𠄿ibrin conversion and activation of factors V, VIII, and XIII, but it also initiates the anticoagulant pathway via activation of protein C with the aid of thrombomodulin on the EC surface. 95 Furthermore, it initiates several cellular and vascular reactions, platelet aggregation, the EC release reaction, and proliferation, as well as the contraction or dilatation of the vessel wall. Figure 3A schematically shows the regulation of thrombin coagulation function through the action of GAGs. HSPGs on the endothelium are known to contain AT-binding sites 91,96� occupied by AT in an intact vascular wall ( Figure 3A ). When thrombin comes in contact with the AT–HSPG complex on the “healthy” intact vascular wall, thrombin is irreversibly inactivated as the covalent thrombin𠄺T (T-AT) complex (as described previously), thus preventing clot formation (Fbng�n). However, SMCs are believed to contain an HSPG without an AT-binding site. When the vessel wall is wounded ( Figure 3B ), the endothelium containing HSPG with AT-binding sites is damaged, allowing thrombin, localized on the HSPG in the underlying SMCs, to catalyze Fbng�n and promote coagulation. 95 During occlusion of the wound by a fibrin clot, blood loss is stopped. The fibrinolytic pathway takes over removing the clot, 99 and tissue regrowth takes place through signaling by heparin-binding growth factors (ie, FGF, vascular endothelial growth factor, etc.). 100

A, In the intact vessel, HSPGs catalyze the inactivation of thrombin (T) and factor Xa by AT through formation of covalent complexes T-AT and Xa-AT. B, In the wounded vessel, the endothelium containing HSPGs with AT-binding sites is lost. Thus, T catalyzes fibrinogen (Fbng)𡤯ibrin (Fbn) clot formation promoting coagulation. Inhibition of T by HC mediated by HSPGs also takes place in the wounded vessel, avoiding subluminal coagulation. C, Chemokines (Cx) are involved in the recruitment of lymphocytes that occur on inflammation. Cx form stable gradients through interaction with HSPG on the endothelium.

A secondary anticoagulant mechanism involves heparin cofactor II (HC), which is achieved by binding to either HSPG or dermatan sulfate proteoglycans such as decorin and biglycan. 101 HC is specific in its inhibition of serine proteases only inactivating thrombin (AT inactivates thrombin, Xa, and other serine proteases). The mechanism of HC inhibition of thrombin is similar to that of AT inhibition of thrombin. 102 HC is viewed as a reserve serine protease inhibitor (a serpin that can replace AT function when AT is deficient) believed to be most important in subluminal anticoagulation.

Other vascular biology is also regulated by HSPG. In inflammation caused by microbial infection or reperfusion injury, 103 chemokines (Cx) are released to establish a gradient ( Figure 3C ). This chemokine gradient spreads out from the site of inflammation into the surrounding tissue and vasculature. 104 Chemokines are also HSPG-binding proteins, and the presence of HSPG stabilizes this chemokine gradient. 105 Neutrophils are chemotactically attracted by this gradient and move toward the endothelium. Their first weak interaction (fast on-rate, moderate off-rate) with the endothelium results from the selectin (Sel) protein binding to its carbohydrate receptors (ie, sialyl Lewis X, HSPG, etc.). 103 The neutrophil rolls along the endothelium, finally coming to rest and anchoring through the strong (slow on-rate, extremely slow off-rate) protein–protein interaction of the integrins. 103,106 The neutrophil then moves through the endothelium to the site of inflammation, where it releases active oxygen species. 107

This simplified description of the role of AT and other heparin-binding proteins (thrombin, HC, Cx, Sel, FGF, etc.) in vascular biology suggests the universal importance of HSPG, the extracellular counterpart to heparin. It also shows the importance of the specificity of GAG–protein interactions. Biology also differs between the arterial and venous vasculature and the result of differences in their molecular, structural, and flow dynamics. Indeed, even within the venous vasculature, major differences can be seen between large vessels, small vessels, and capillaries.


Discussion

Binding of HSV gD to an entry receptor probably mediates conformational changes in gD, which could enable subsequent interactions with gB and/or gH-gL, to induce the membrane-fusing activity required for cell fusion and viral entry. This hypothesis has led to a search for specific domains in gD that could engage in these interactions. We and others (6) have identified a region in gD-H1 (amino acids 262–285) that appears to be required for cell fusion and viral entry but not for receptor binding. We propose, for reasons given below and in contrast to conclusions of the other study (6), that there is probably no specific interaction domain for gB or gH-gL within this region, but that properties of this region (amino acid composition, spacing of particular amino acids such as Pro, and total length) may be necessary for gD to assume conformations critical for fusion activity. It seems likely that domains for functional interaction with gB and/or gH-gL are present in gD but they probably lie elsewhere, perhaps overlapping the receptor-binding regions.

Structural coordinates for regions of the gD-H1 ectodomain downstream of amino acid 259, in gD cocrystallized with HVEM, and both upstream of amino acid 14 and downstream of amino acid 255, in gD crystallized alone, have not been determined even though the truncated form of gD used comprised amino acids 1–285 (7). Two lines of evidence suggest that regions in gD downstream of amino acid 285 may be engaged in interactions with upstream regions of gD. First, soluble forms of gD truncated after amino acids 250, 260, or 285 bind to HVEM and nectin-1 with affinities ≈100-fold higher than that characteristic of gD truncated at amino acid 306 (11), suggesting that a region between amino acids 285 and 306 influences conformation of the upstream receptor-binding domains. Second, results obtained with the mAb AP7 demonstrate that amino acids substitutions at positions 25 and 27 in the N terminus and deletions encompassing amino acids 290–300 in the C terminus can destroy its epitope, but not those of other conformation-dependent mAbs, such as HD1 and DL11 (20, 27, 31). Consistent with these findings, our results showed that the only chimera displaying an AP7 epitope was CH6.1, which has its entire ectodomain from gD-H1. Thus, both the extreme N-terminal and C-terminal regions of the gD ectodomain determine the conformation of the AP7 epitope and may even physically interact to form or influence conformation of this epitope. If so, regions of gD between amino acids 250 and 285 must, at least under certain conditions, assume a conformation enabling the N terminus to interact with the membrane-proximal region of the ectodomain. The sequences of gD-H1 and gD-P downstream of amino acids 241 and 225, respectively, extending to the membrane spans, are very Pro-rich (Fig. 1). The PRV sequence in this region is longer and has more Pro residues, many spaced differently from those in the membrane-proximal region of gD-H1. Although Pro residues introduce constraints on conformation, they are often abundant in flexible regions of a protein, perhaps because their presence precludes certain types of secondary structure.

Our finding that replacement of gD-H1 sequences downstream of amino acid 261 with PRV sequences (CH4.1) failed to permit cell fusion, whereas replacement downstream of amino acid 285 permitted cell fusion (CH5.1), suggests the possibility that a specific HSV-1 sequence between amino acids 262 and 285 is required for cell fusion. Deletions in gD-H1 across this region had little effect on cell fusion activity (Fig. 5), except in the case of Δ270–279. Because this deletion reduced cell fusion activity no more than 50%, it seems likely that there is no specific sequence within the region from amino acids 262–285 that is absolutely essential for fusion activity. An alternative explanation is that this region permits N-terminal/C-terminal interactions within gD that are critical for fusion activity and/or permits receptor-dependent conformational changes within the receptor-binding domains. The former possibility, if true, implies that PRV sequences downstream of amino acid 282 can substitute for gD-H1 sequences downstream of amino acid 285, to mediate these N-terminal/C-terminal interactions, because CH5.1 and CH7.1 both are active in inducing cell fusion. Considering cell fusion activity in proportion to receptor-binding activity (Fig. 3), it may be that CH6.1, containing the entire gD-H1 ectodomain, is even more active in cell fusion than CH5.1 and CH7.1.

Our results also defined a region in gD-H1 (amino acids 250–255) that influences binding to both HVEM and nectin-1 and, to a larger extent, cell fusion activity with both receptors (Fig. 5). This finding appears to be at variance with previous results that soluble forms of gD truncated after amino acid 250 can bind to both receptors with equivalent or higher affinity than does gD truncated after amino acids 260, 285, or 306. The explanation very likely lies in the fact that the deletion mutant tested here was a membrane-bound nontruncated form of gD, constrained by being anchored in a membrane and retaining sequences at the C terminus of the ectodomain that could influence conformation of upstream regions. Ala-scanning mutations at each of the positions from amino acids 250–255 revealed that the precise amino acid sequence of this region is not important for its function in receptor binding or cell fusion.

The results presented here and elsewhere (6) identify a domain in gD-H1 that can be targeted to prevent HSV-induced membrane fusion, independently of blocking receptor binding. Agents that interfere with the function of this domain can be expected to block viral entry and virus-induced cell fusion.


Contents

Elective

Neonatal circumcision is usually elected by the parents for non-medical reasons, such as religious beliefs or personal preferences, possibly driven by societal norms. [6] Outside the parts of Africa with high prevalence of HIV/AIDS, the positions of the world's major medical organizations on non-therapeutic neonatal circumcision range from considering it as having a modest net health benefit that outweighs small risks, to viewing it as having no benefit with significant risks for harm. [7] No major medical organization recommends universal neonatal circumcision, and no major medical organization calls for banning it either. [7] The Royal Dutch Medical Association, which expresses some of the strongest opposition to routine neonatal circumcision, argues that while there are valid reasons for banning it, doing so could lead parents who insist on the procedure to turn to poorly trained practitioners instead of medical professionals. [7] [28] This argument to keep the procedure within the purview of medical professionals is found across all major medical organizations. [7] In addition, the organizations advise medical professionals to yield to some degree to parental preferences, which are commonly based upon cultural or religious views, in their decision to agree to circumcise. [7] The Danish College of General Practitioners states that circumcision should "only [be done] when medically needed, otherwise it is a case of mutilation." [29]

Medical

Circumcision may be used to treat pathological phimosis, refractory balanoposthitis and chronic or recurrent urinary tract infections (UTIs). [5] [6] The WHO promotes circumcision to prevent female-to-male HIV transmission in countries with high rates of HIV. [10] The International AIDS Society-USA also suggests circumcision be discussed with men who have insertive anal sex with men, especially in regions where HIV is common. [30]

The finding that circumcision significantly reduces female-to-male HIV transmission has prompted medical organizations serving communities affected by endemic HIV/AIDS to promote circumcision as an additional method of controlling the spread of HIV. [7] In 2007 the WHO and the Joint United Nations Programme on HIV/AIDS (UNAIDS) recommended circumcision as part of a comprehensive program for prevention of HIV transmission in areas with high endemic rates of HIV, as long as the program includes "informed consent, confidentiality, and absence of coercion". [10]

Circumcision is contraindicated in infants with certain genital structure abnormalities, such as a misplaced urethral opening (as in hypospadias and epispadias), curvature of the head of the penis (chordee), or ambiguous genitalia, because the foreskin may be needed for reconstructive surgery. Circumcision is contraindicated in premature infants and those who are not clinically stable and in good health. [1] [6] [31] If an individual, child or adult, is known to have or has a family history of serious bleeding disorders (hemophilia), it is recommended that the blood be checked for normal coagulation properties before the procedure is attempted. [6] [31]

The foreskin extends out from the base of the glans and covers the glans when the penis is flaccid. Proposed theories for the purpose of the foreskin are that it serves to protect the penis as the fetus develops in the mother's womb, that it helps to preserve moisture in the glans, and that it improves sexual pleasure. The foreskin may also be a pathway of infection for certain diseases. Circumcision removes the foreskin at its attachment to the base of the glans. [4]

Removal of the foreskin

For infant circumcision, devices such as the Gomco clamp, Plastibell and Mogen clamp are commonly used in the USA. [3] These follow the same basic procedure. First, the amount of foreskin to be removed is estimated. The practitioner opens the foreskin via the preputial orifice to reveal the glans underneath and ensures it is normal before bluntly separating the inner lining of the foreskin (preputial epithelium) from its attachment to the glans. The practitioner then places the circumcision device (this sometimes requires a dorsal slit), which remains until blood flow has stopped. Finally, the foreskin is amputated. [3] For older babies and adults, circumcision is often performed surgically without specialized instruments, [31] and alternatives such as Unicirc or the Shang ring are available. [32]

Pain management

The circumcision procedure causes pain, and for neonates this pain may interfere with mother-infant interaction or cause other behavioral changes, [33] so the use of analgesia is advocated. [3] [34] Ordinary procedural pain may be managed in pharmacological and non-pharmacological ways. Pharmacological methods, such as localized or regional pain-blocking injections and topical analgesic creams, are safe and effective. [3] [35] [36] The ring block and dorsal penile nerve block (DPNB) are the most effective at reducing pain, and the ring block may be more effective than the DPNB. They are more effective than EMLA (eutectic mixture of local anesthetics) cream, which is more effective than a placebo. [35] [36] Topical creams have been found to irritate the skin of low birth weight infants, so penile nerve block techniques are recommended in this group. [3]

For infants, non-pharmacological methods such as the use of a comfortable, padded chair and a sucrose or non-sucrose pacifier are more effective at reducing pain than a placebo, [36] but the American Academy of Pediatrics (AAP) states that such methods are insufficient alone and should be used to supplement more effective techniques. [3] A quicker procedure reduces duration of pain use of the Mogen clamp was found to result in a shorter procedure time and less pain-induced stress than the use of the Gomco clamp or the Plastibell. [36] The available evidence does not indicate that post-procedure pain management is needed. [3] For adults, topical anesthesia, ring block, dorsal penile nerve block (DPNB) and general anesthesia are all options, [37] and the procedure requires four to six weeks of abstinence from masturbation or intercourse to allow the wound to heal. [31]

Sexually transmitted diseases

Human immunodeficiency virus

There is strong evidence that circumcision reduces the risk of men acquiring HIV infection in areas of the world with high rates of HIV. This evidence is principally derived from three randomized controlled studies conducted in Africa in 2002. [38] [11] Evidence among heterosexual men in sub-Saharan Africa shows an absolute decrease in risk of 1.8% which is a relative decrease of between 38% and 66% over two years, [11] and in this population studies rate it cost effective. [39] Whether it is of benefit in developed countries is undetermined. [12]

There are plausible explanations based on human biology for how circumcision can decrease the likelihood of female-to-male HIV transmission. The superficial skin layers of the penis contain Langerhans cells, which are targeted by HIV removing the foreskin reduces the number of these cells. When an uncircumcised penis is erect during intercourse, any small tears on the inner surface of the foreskin come into direct contact with the vaginal walls, providing a pathway for transmission. When an uncircumcised penis is flaccid, the pocket between the inside of the foreskin and the head of the penis provides an environment conducive to pathogen survival circumcision eliminates this pocket. Some experimental evidence has been provided to support these theories. [40]

The WHO and the UNAIDS state that male circumcision is an efficacious intervention for HIV prevention, but should be carried out by well-trained medical professionals and under conditions of informed consent (parents' consent for their infant boys). [4] < [10] [41] The WHO has judged circumcision to be a cost-effective public health intervention against the spread of HIV in Africa, although not necessarily more cost-effective than condoms. [4] The joint WHO/UNAIDS recommendation also notes that circumcision only provides partial protection from HIV and should not replace known methods of HIV prevention. [10]

Male circumcision provides only indirect HIV protection for heterosexual women. [3] [42] [43] It is unknown whether or not circumcision reduces transmission when men engage in anal sex with a female partner. [41] [44] Some evidence supports its effectiveness at reducing HIV risk in men who have sex with men. [13]

Human papillomavirus

Human papillomavirus (HPV) is the most commonly transmitted sexually transmitted infection, affecting both men and women. While most infections are asymptomatic and are cleared by the immune system, some types of the virus cause genital warts, and other types, if untreated, cause various forms of cancer, including cervical cancer, and penile cancer. Genital warts and cervical cancer are the two most common problems resulting from HPV. [45]

Circumcision is associated with a reduced prevalence of oncogenic types of HPV infection, meaning that a randomly selected circumcised man is less likely to be found infected with cancer-causing types of HPV than an uncircumcised man. [46] [47] It also decreases the likelihood of multiple infections. [15] As of 2012 [update] there was no strong evidence that it reduces the rate of new HPV infection, [14] [15] [48] but the procedure is associated with increased clearance of the virus by the body, [14] [15] which can account for the finding of reduced prevalence. [15]

Although genital warts are caused by a type of HPV, there is no statistically significant relationship between being circumcised and the presence of genital warts. [14] [47] [48]

Other infections

Studies evaluating the effect of circumcision on the rates of other sexually transmitted infections have generally, found it to be protective. A 2006 meta-analysis found that circumcision was associated with lower rates of syphilis, chancroid and possibly genital herpes. [49] A 2010 review found that circumcision reduced the incidence of HSV-2 (herpes simplex virus, type 2) infections by 28%. [50] The researchers found mixed results for protection against trichomonas vaginalis and chlamydia trachomatis, and no evidence of protection against gonorrhea or syphilis. [50] It may also possibly protect against syphilis in men who have sex with men. [51]

Phimosis, balanitis and balanoposthitis

Phimosis is the inability to retract the foreskin over the glans penis. [52] At birth, the foreskin cannot be retracted due to adhesions between the foreskin and glans, and this is considered normal (physiological phimosis). [52] Over time the foreskin naturally separates from the glans, and a majority of boys are able to retract the foreskin by age three. [52] Less than one percent are still having problems at age 18. [52] If the inability to do so becomes problematic (pathological phimosis) circumcision is a treatment option. [5] [53] This pathological phimosis may be due to scarring from the skin disease balanitis xerotica obliterans (BXO), repeated episodes of balanoposthitis or forced retraction of the foreskin. [54] Steroid creams are also a reasonable option and may prevent the need for surgery including in those with mild BXO. [54] [55] The procedure may also be used to prevent the development of phimosis. [6] Phimosis is also a complication that can result from circumcision. [56]

An inflammation of the glans penis and foreskin is called balanoposthitis, and the condition affecting the glans alone is called balanitis. [57] [58] Most cases of these conditions occur in uncircumcised males, [59] affecting 4–11% of that group. [60] The moist, warm space underneath the foreskin is thought to facilitate the growth of pathogens, particularly when hygiene is poor. Yeasts, especially Candida albicans, are the most common penile infection and are rarely identified in samples taken from circumcised males. [59] Both conditions are usually treated with topical antibiotics (metronidazole cream) and antifungals (clotrimazole cream) or low-potency steroid creams. [57] [58] Circumcision is a treatment option for refractory or recurrent balanoposthitis, but in the twenty-first century the availability of the other treatments has made it less necessary. [57] [58]

Urinary tract infections

A UTI affects parts of the urinary system including the urethra, bladder, and kidneys. There is about a one percent risk of UTIs in boys under two years of age, and the majority of incidents occur in the first year of life. There is good but not ideal evidence that circumcision of babies reduces the incidence of UTIs in boys under two years of age, and there is fair evidence that the reduction in incidence is by a factor of 3–10 times (100 circumcisions prevents one UTI). [3] [61] [62] Circumcision is most likely to benefit boys who have a high risk of UTIs due to anatomical defects, [3] and may be used to treat recurrent UTIs. [5]

There is a plausible biological explanation for the reduction in UTI risk after circumcision. The orifice through which urine passes at the tip of the penis (the urinary meatus) hosts more urinary system disease-causing bacteria in uncircumcised boys than in circumcised boys, especially in those under six months of age. As these bacteria are a risk factor for UTIs, circumcision may reduce the risk of UTIs through a decrease in the bacterial population. [3] [62]

Cancers

Circumcision has a protective effect against the risks of penile cancer in men, and cervical cancer in the female sexual partners of heterosexual men. Penile cancer is rare, with about 1 new case per 100,000 people per year in developed countries, and higher incidence rates per 100,000 in sub-Saharan Africa (for example: 1.6 in Zimbabwe, 2.7 in Uganda and 3.2 in Eswatini). [63] The number of new cases is also high in some South American countries including Paraguay and Uruguay, at about 4.3 per 100,000. [64] It is least common in Israeli Jews—0.1 per 100,000—related in part to the very high rate of circumcision of babies. [65]

Penile cancer development can be detected in the carcinoma in situ (CIS) cancerous precursor stage and at the more advanced invasive squamous cell carcinoma stage. [3] Childhood or adolescent circumcision is associated with a reduced risk of invasive squamous cell carcinoma in particular. [3] [63] There is an association between adult circumcision and an increased risk of invasive penile cancer this is believed to be from men being circumcised as a treatment for penile cancer or a condition that is a precursor to cancer rather than a consequence of circumcision itself. [63] Penile cancer has been observed to be nearly eliminated in populations of males circumcised neonatally. [60]

Important risk factors for penile cancer include phimosis and HPV infection, both of which are mitigated by circumcision. [63] The mitigating effect circumcision has on the risk factor introduced by the possibility of phimosis is secondary, in that the removal of the foreskin eliminates the possibility of phimosis. This can be inferred from study results that show uncircumcised men with no history of phimosis are equally likely to have penile cancer as circumcised men. [3] [63] Circumcision is also associated with a reduced prevalence of cancer-causing types of HPV in men [15] and a reduced risk of cervical cancer (which is caused by a type of HPV) in female partners of men. [6] As penile cancer is rare (and may become increasingly rare as HPV vaccination rates rise), and circumcision has risks, the practice is not considered to be valuable solely as a prophylactic measure against penile cancer in the United States. [3] [60] [66]

There is some evidence that circumcision is associated with lower risk of prostate cancer. A 2015 meta-analysis found a reduced risk of prostate cancer associated with circumcision in black men. [67] A 2016 meta-analysis found that men with prostate cancer were less likely to be circumcised. [68]

Women's health

A 2017 systematic review found consistent evidence that male circumcision prior to heterosexual contact was associated with a decreased risk of cervical cancer, cervical dysplasia, HSV-2, chlamydia, and syphilis among women. The evidence was less consistent in regards to the potential association of circumcision with women's risk of HPV and HIV. [69]

Neonatal circumcision is generally safe when done by an experienced practitioner. [70] [71] The most common acute complications are bleeding, infection and the removal of either too much or too little foreskin. [3] [72] These complications occur in approximately 0.13% of procedures, with bleeding being the most common acute complication in the United States. [72] Minor complications are reported to occur in three percent of procedures. [70] Severe complications are rare. [73] A specific complication rate is difficult to determine due to scant data on complications and inconsistencies in their classification. [3] Complication rates are greater when the procedure is performed by an inexperienced operator, in unsterile conditions, or when the child is at an older age. [17] Significant acute complications happen rarely, [3] [17] occurring in about 1 in 500 newborn procedures in the United States. [3] Severe to catastrophic complications, including death, are so rare that they are reported only as individual case reports. [3] [71] Where a Plastibell device is used, the most common complication is the retention of the device occurring in around 3.5% of procedures. [18] Other possible complications include buried penis, chordee, phimosis, skin bridges, urethral fistulas, and meatal stenosis. [71] [74] These complications may be partly avoided with proper technique, and are often treatable without requiring surgical revision. [71] The most common long-term complication is meatal stenosis, this is almost exclusively seen in circumcised children, it is thought to be caused by ammonia producing bacteria coming into contact with the meatus in circumcised infants. [18] It can be treated by meatotomy. [18]

Effective pain management should be used. [3] Inadequate pain relief may carry the risks of heightened pain response for newborns. [33] Newborns that experience pain due to being circumcised have different responses to vaccines given afterwards, with higher pain scores observed. [75] For adult men who have been circumcised, there is a risk that the circumcision scar may be tender. [76]

Sexual effects

The extent to which circumcision affects penile sensitivity and sexual satisfaction is controversial some research has found a loss of sensation while other research has found enhanced sensation. [77] The highest quality evidence indicates that circumcision does not decrease the sensitivity of the penis, harm sexual function or reduce sexual satisfaction. [19] [78] [79] A 2013 systematic review found that circumcision did not appear to adversely affect sexual desire, pain with intercourse, premature ejaculation, time until ejaculation, erectile dysfunction or difficulties with orgasm. [80] However, the study found that the existing evidence is not very good. [80] A 2017 review found that circumcision did not affect premature ejaculation. [81] When it comes to sexual partners' experiences, circumcision has an unclear effect as it has not been well studied. [82]

Psychological effects

Overall, as of 2019 [update] it is unclear what the psychological outcomes of circumcision are, with some studies showing negative effects, and others showing that the effects are negligible. [83] There is no good evidence that circumcision adversely affects cognitive abilities. [83] There is debate in the literature over whether the pain of circumcision has lasting psychological impact, with only weak underlying data available. [83]

Circumcision is one of the world's most widely performed medical procedures. [23] Approximately 37% to 39% of males worldwide are circumcised, about half for religious or cultural reasons. [84] It is most often practiced between infancy and the early twenties. [4] The WHO estimated in 2007 that 664,500,000 males aged 15 and over were circumcised (30–33% global prevalence), almost 70% of whom were Muslim. [4] Circumcision is most common in the Muslim world, Israel, South Korea, the United States and parts of Southeast Asia and Africa. It is relatively rare in Europe, Latin America, parts of Southern Africa and Oceania and most of non-Muslim Asia. Prevalence is near-universal in the Middle East and Central Asia. [4] [85] Non-religious circumcision in Asia, outside of the Republic of Korea and the Philippines, is fairly rare, [4] and prevalence is generally low (less than 20%) across Europe. [4] [86] Estimates for individual countries include Taiwan at 9% [87] and Australia 58.7%. [88] Prevalence in the United States and Canada is estimated at 75% and 30% respectively. [4] Prevalence in Africa varies from less than 20% in some southern African countries to near universal in North and West Africa. [85]

The rates of routine neonatal circumcision over time have varied significantly by country. In the United States, hospital discharge surveys estimated rates at 64.7% in the year 1980, 59.0% in the year 1990, 62.4% in the year 2000, and 58.3% in the year 2010. [89] These estimates are lower than the overall circumcision rates, as they do not account for non-hospital circumcisions, [89] or for procedures performed for medical or cosmetic reasons later in life [4] [89] community surveys have reported higher neonatal circumcision. [4] Canada has seen a slow decline since the early 1970s, possibly influenced by statements from the AAP and the Canadian Pediatric Society issued in the 1970s saying that the procedure was not medically indicated. [4] In Australia, the rate declined in the 1970s and 80s, but has been increasing slowly as of 2004. [4] In the United Kingdom, rates are likely to have been 20–30% in the 1940s but declined at the end of that decade. One possible reason may have been a 1949 British Medical Journal article which stated that there was no medical reason for the general circumcision of babies. [4] The overall prevalence of circumcision in South Korea has increased markedly in the second half of the 20th century, rising from near zero around 1950 to about 60% in 2000, with the most significant jumps in the last two decades of that time period. [4] This is probably due to the influence of the United States, which established a trusteeship for the country following World War II. [4]

Medical organizations can affect the neonatal circumcision rate of a country by influencing whether the costs of the procedure are borne by the parents or are covered by insurance or a national health care system. [7] Policies that require the costs to be paid by the parents yield lower neonatal circumcision rates. [7] The decline in the rates in the UK is one example another is that in the United States, the individual states where insurance or Medicaid covers the costs have higher rates. [7] Changes to policy are driven by the results of new research, and moderated by the politics, demographics, and culture of the communities. [7]

Circumcision is the world's oldest planned surgical procedure, suggested by anatomist and hyperdiffusionist historian Grafton Elliot Smith to be over 15,000 years old, pre-dating recorded history. There is no firm consensus as to how it came to be practiced worldwide. One theory is that it began in one geographic area and spread from there another is that several different cultural groups began its practice independently. In his 1891 work History of Circumcision, physician Peter Charles Remondino suggested that it began as a less severe form of emasculating a captured enemy: penectomy or castration would likely have been fatal, while some form of circumcision would permanently mark the defeated yet leave him alive to serve as a slave. [24] [90]

The history of the migration and evolution of the practice of circumcision is followed mainly through the cultures and peoples in two separate regions. In the lands south and east of the Mediterranean, starting with Sudan and Ethiopia, the procedure was practiced by the ancient Egyptians and the Semites, and then by the Jews and Muslims, with whom the practice travelled to and was adopted by the Bantu Africans. In Oceania, circumcision is practiced by the Australian Aboriginals and Polynesians. [90] There is also evidence that circumcision was practiced among the Aztec and Mayan civilizations in the Americas, [4] but little detail is available about its history. [23] [24]

Middle East, Africa and Europe

Evidence suggests that circumcision was practiced in the Middle East by the 4th millennium BCE, when the Sumerians and the Semites moved into the area that is modern-day Iraq from the North and West. [23] The earliest historical record of circumcision comes from Egypt, in the form of an image of the circumcision of an adult carved into the tomb of Ankh-Mahor at Saqqara, dating to about 2400–2300 BCE. Circumcision was done by the Egyptians possibly for hygienic reasons, but also was part of their obsession with purity and was associated with spiritual and intellectual development. No well-accepted theory explains the significance of circumcision to the Egyptians, but it appears to have been endowed with great honor and importance as a rite of passage into adulthood, performed in a public ceremony emphasizing the continuation of family generations and fertility. It may have been a mark of distinction for the elite: the Egyptian Book of the Dead describes the sun god Ra as having circumcised himself. [24] [90]

Though secular scholars consider the story to be literary and not historical, [91] circumcision features prominently in the Hebrew Bible. The narrative in Genesis chapter 17 describes the circumcision of Abraham and his relatives and slaves. In the same chapter, Abraham's descendants are commanded to circumcise their sons on the eighth day of life as part of a covenant with God.

In addition to proposing that circumcision was taken up by the Israelites purely as a religious mandate, scholars have suggested that Judaism's patriarchs and their followers adopted circumcision to make penile hygiene easier in hot, sandy climates as a rite of passage into adulthood or as a form of blood sacrifice. [23] [90] [92]

Alexander the Great conquered the Middle East in the 4th century BCE, and in the following centuries ancient Greek cultures and values came to the Middle East. The Greeks abhorred circumcision, making life for circumcised Jews living among the Greeks (and later the Romans) very difficult. Antiochus Epiphanes outlawed circumcision, as did Hadrian, which helped cause the Bar Kokhba revolt. During this period in history, Jewish circumcision called for the removal of only a part of the prepuce, and some Hellenized Jews attempted to look uncircumcised by stretching the extant parts of their foreskins. This was considered by the Jewish leaders to be a serious problem, and during the 2nd century CE they changed the requirements of Jewish circumcision to call for the complete removal of the foreskin, [93] emphasizing the Jewish view of circumcision as intended to be not just the fulfillment of a Biblical commandment but also an essential and permanent mark of membership in a people. [90] [92]

A narrative in the Christian Gospel of Luke makes a brief mention of the circumcision of Jesus, but the subject of physical circumcision itself is not part of the received teachings of Jesus. Paul the Apostle reinterpreted circumcision as a spiritual concept, arguing the physical one to be unnecessary for Gentile converts to Christianity. The teaching that physical circumcision was unnecessary for membership in a divine covenant was instrumental in the separation of Christianity from Judaism. Although it is not explicitly mentioned in the Quran (early 7th century CE), circumcision is considered essential to Islam, and it is nearly universally performed among Muslims. The practice of circumcision spread across the Middle East, North Africa, and Southern Europe with Islam. [94]

Genghis Khan and the following Yuan Emperors in China forbade Islamic practices such as halal butchering and circumcision. [95] [96] This led Chinese Muslims to eventually take an active part in rebelling against the Mongols and installing the Ming Dynasty.

The practice of circumcision is thought to have been brought to the Bantu-speaking tribes of Africa by either the Jews after one of their many expulsions from European countries, or by Muslim Moors escaping after the 1492 reconquest of Spain. In the second half of the 1st millennium CE, inhabitants from the North East of Africa moved south and encountered groups from Arabia, the Middle East, and West Africa. These people moved south and formed what is known today as the Bantu. Bantu tribes were observed to be upholding what was described as Jewish law, including circumcision, in the 16th century. Circumcision and elements of Jewish dietary restrictions are still found among Bantu tribes. [23]

Indigenous peoples

Circumcision is practiced by some groups amongst Australian Aboriginal peoples, Polynesians, and Native Americans. [ citation needed ] Little information is available about the origins and history of circumcision among these peoples, compared to circumcision in the Middle East. [ citation needed ]

For Aboriginal Australians and Polynesians, circumcision likely started as a blood sacrifice and a test of bravery and became an initiation rite with attendant instruction in manhood in more recent centuries. Often seashells were used to remove the foreskin, and the bleeding was stopped with eucalyptus smoke. [23] [97]

Christopher Columbus reported circumcision being practiced by Native Americans. [24] It was also practiced by the Incas, Aztecs, and Mayans. It probably started among South American tribes as a blood sacrifice or ritual mutilation to test bravery and endurance, and its use later evolved into a rite of initiation. [23]

Modern times

Circumcision did not become a common medical procedure in the Anglophone world until the late 19th century. [98] At that time, British and American doctors began recommending it primarily as a deterrent to masturbation. [98] [99] Prior to the 20th century, masturbation was believed to be the cause of a wide range of physical and mental illnesses including epilepsy, paralysis, impotence, gonorrhea, tuberculosis, feeblemindedness, and insanity. [100] [101] In 1855, motivated in part by an interest in promoting circumcision to reduce masturbation, English physician Jonathan Hutchinson published his findings that Jews had a lower prevalence of certain venereal diseases. [102] While pursuing a successful career as a general practitioner, Hutchinson went on to advocate circumcision for health reasons for the next fifty years, [102] and eventually earned a knighthood for his overall contributions to medicine. [103] In America, one of the first modern physicians to advocate the procedure was Lewis Sayre, a founder of the American Medical Association. In 1870, Sayre began using circumcision as a purported cure for several cases of young boys diagnosed with paralysis or significant motor problems. He thought the procedure ameliorated such problems based on a "reflex neurosis" theory of disease, which held that excessive stimulation of the genitals was a disturbance to the equilibrium of the nervous system and a cause of systemic problems. [98] The use of circumcision to promote good health also fit in with the germ theory of disease during that time, which saw the foreskin as being filled with infection-causing smegma (a mixture of shed skin cells and oils). Sayre published works on the subject and promoted it energetically in speeches. Contemporary physicians picked up on Sayre's new treatment, which they believed could prevent or cure a wide-ranging array of medical problems and social ills. Its popularity spread with publications such as Peter Charles Remondino's History of Circumcision. By the turn of the century infant circumcision was near universally recommended in America and Great Britain. [24] [99] David Gollaher proposes that "Americans found circumcision appealing not merely on medical grounds, but also for its connotations of science, health, and cleanliness—newly important class distinctions" in a country where 17 million immigrants arrived between 1890 and 1914. [104]

After the end of World War II, Britain implemented a National Health Service, and so looked to ensure that each medical procedure covered by the new system was cost-effective and the procedure for non-medical reasons was not covered by the national healthcare system. Douglas Gairdner's 1949 article "The Fate of the Foreskin" argued that the evidence available at that time showed that the risks outweighed the known benefits. [105] Circumcision rates dropped in Britain and in the rest of Europe. In the 1970s, national medical associations in Australia and Canada issued recommendations against routine infant circumcision, leading to drops in the rates of both of those countries. The United States made similar statements in the 1970s, but stopped short of recommending against it, simply stating that it has no medical benefit. Since then they have amended their policy statements several times, with the current recommendation being that the benefits outweigh the risks, but they do not recommend it routinely. [24] [99]

An association between circumcision and reduced heterosexual HIV infection rates was suggested in 1986. [24] Experimental evidence was needed to establish a causal relationship, so three randomized controlled trials were commissioned as a means to reduce the effect of any confounding factors. [11] Trials took place in South Africa, Kenya and Uganda. [11] All three trials were stopped early by their monitoring boards because those in the circumcised group had a lower rate of HIV contraction than the control group. [11] WHO assessed these as "gold standard" studies and found "strong and consistent" evidence from later studies that confirmed the results. Currently, WHO continues to promote circumcision in high-risk populations as part of an overall program to reduce the spread of HIV. [10] Some have challenged the validity of the African randomized controlled trials. [106] [107] [108] [109] The Male Circumcision Clearinghouse website was formed in 2009 by WHO, UNAIDS, FHI and AVAC to provide current evidence-based guidance, information, and resources to support the delivery of safe male circumcision services in countries that choose to scale up the procedure as one component of comprehensive HIV prevention services. [110] [111]

Cultures and religions

In some cultures, males are generally required to be circumcised shortly after birth, during childhood or around puberty as part of a rite of passage. Circumcision is commonly practiced in the Jewish and Islamic faiths and in Coptic Christianity and the Ethiopian Orthodox Church and the Eritrean Orthodox Tewahedo Church. [7] [25] [26] [27] [112] [113] [114]

Judaism

Circumcision is very important to most branches of Judaism, with over 90% of male adherents having the procedure performed as a religious obligation. The basis for its observance is found in the Torah of the Hebrew Bible, in Genesis chapter 17, in which a covenant of circumcision is made with Abraham and his descendants. Jewish circumcision is part of the brit milah ritual, to be performed by a specialist ritual circumciser, a mohel, on the eighth day of a newborn son's life, with certain exceptions for poor health. Jewish law requires that the circumcision leaves the glans bare when the penis is flaccid. Converts to Conservative and Orthodox Judaism must also be circumcised those who are already circumcised undergo a symbolic circumcision ritual. Circumcision is not required by Judaism for one to be considered Jewish, but some adherents foresee serious negative spiritual consequences if it is neglected. [25] [115]

According to traditional Jewish law, in the absence of an adult free Jewish male expert, a woman, a slave, or a child who has the required skills is also authorized to perform the circumcision, provided that they are Jewish. [116] However, most streams of non-Orthodox Judaism allow female mohels, called mohalot (Hebrew: מוֹהֲלוֹת ‎, the plural of מוֹהֶלֶת mohelet, feminine of mohel), without restriction. In 1984 Deborah Cohen became the first certified Reform mohelet she was certified by the Berit Mila program of Reform Judaism. [117] Some contemporary Jews in the United States choose not to circumcise their sons. [118] They are assisted by a small number of Reform and Reconstructionist rabbis, and have developed a welcoming ceremony that they call the brit shalom ("Covenant [of] Peace") for such children, also accepted by Humanistic Judaism. [119] [120]

This ceremony of brit shalom is not officially approved of by the Reform or Reconstructionist rabbinical organizations, who make the recommendation that male infants should be circumcised, though the issue of converts remains controversial [121] [122] and circumcision of converts is not mandatory in either movement. [123]

Islam

Although there is some debate within Islam over whether it is a religious requirement, circumcision (called khitan) is practiced nearly universally by Muslim males. Islam bases its practice of circumcision on the Genesis 17 narrative, the same Biblical chapter referred to by Jews. The procedure is not explicitly mentioned in the Quran, however, it is a tradition established by Islam's prophet Muhammad directly (following Abraham), and so its practice is considered a sunnah (prophet's tradition) and is very important in Islam. For Muslims, circumcision is also a matter of cleanliness, purification and control over one's baser self (nafs). There is no agreement across the many Islamic communities about the age at which circumcision should be performed. It may be done from soon after birth up to about age 15 most often it is performed at around six to seven years of age. The timing can correspond with the boy's completion of his recitation of the whole Quran, with a coming-of-age event such as taking on the responsibility of daily prayer or betrothal. Circumcision may be celebrated with an associated family or community event. Circumcision is recommended for, but is not required of, converts to Islam. [27] [112] [124]

Christianity

The New Testament chapter Acts 15 records that Christianity did not require circumcision. In 1442 the Catholic Church banned the practice of religious circumcision in the 11th Council of Florence [125] and currently maintains a neutral position on the practice of non-religious circumcision. [126] Coptic Christians practice circumcision as a rite of passage. [4] [26] [114] [127] The Ethiopian Orthodox Church calls for circumcision, with near-universal prevalence among Orthodox men in Ethiopia. [4] Some Christian churches in South Africa disapprove of the practice, while others require it of their members. [4]

African cultures

Certain African cultural groups, such as the Yoruba and the Igbo of Nigeria, customarily circumcise their infant sons. The procedure is also practiced by some cultural groups or individual family lines in Sudan, Democratic Republic of the Congo, Uganda and in southern Africa. For some of these groups, circumcision appears to be purely cultural, done with no particular religious significance or intention to distinguish members of a group. For others, circumcision might be done for purification, or it may be interpreted as a mark of subjugation. Among these groups, even when circumcision is done for reasons of tradition, it is often done in hospitals. [113] The Maasai people, who live predominantly in Kenya and Tanzania, use circumcision as a rite of passage. It is also used for distinguished age groups. This is usually done after every fifteen years where a new "age set" are formed. The new members are to undergo initiation at the same time. Whenever new age groups are initiated, they will become novice warriors and replace the previous group. The new initiates will be given a unique name that will be an important marker of the history of the Maasai. No anesthesia is used, and initiates have to endure the pain or be called flinchers. [128] The Xhosa community practice circumcision as a sacrifice. In doing so, young boys will announce to their family members when they are ready for circumcision by singing. The sacrifice is the blood spilt during the initiation procedure. Young boys will be considered an "outsiders" unless they undergo circumcision. [129] It is not clear how many deaths and injuries result from non-clinical circumcisions. [130]

Australian cultures

Some Australian Aborigines use circumcision as a test of bravery and self-control as a part of a rite of passage into manhood, which results in full societal and ceremonial membership. It may be accompanied by body scarification and the removal of teeth, and may be followed later by penile subincision. Circumcision is one of many trials and ceremonies required before a youth is considered to have become knowledgeable enough to maintain and pass on the cultural traditions. During these trials, the maturing youth bonds in solidarity with the men. Circumcision is also strongly associated with a man's family, and it is part of the process required to prepare a man to take a wife and produce his own family. [113]

Filipino culture

In the Philippines, circumcision known as "tuli" is sometimes viewed as a rite of passage. [131] About 93% of Filipino men are circumcised. [131] Often this occurs, in April and May, when Filipino boys are taken by their parents. The practice dates back to the arrival of Islam in 1450. Pressure to be circumcised is even in the language: one Tagalog word for 'uncircumcised' is supot, meaning 'coward' literally. A circumcised eight or ten year-old is no longer considered a boy and is given more adult roles in the family and society. [132]

Ethical and legal issues

There is a long-running and vigorous debate over ethical concerns regarding circumcision, particularly neonatal circumcision for reasons other than intended direct medical benefit. There are three parties involved in the decision to circumcise a minor: the minor as the patient, the parents (or other guardians) and the physician. The physician is bound under the ethical principles of beneficence (promoting well-being) and non-maleficence ("first, do no harm"), and so is charged with the responsibility to promote the best interests of the patient while minimizing unnecessary harms. Those involved must weigh the factors of what is in the best interest of the minor against the potential harms of the procedure. [9]

With a newborn involved, the decision is made more complex due to the principles of respect for autonomy and consent, as a newborn cannot understand or engage in a logical discussion of his own values and best interests. [8] [9] A mentally more mature child can understand the issues involved to some degree, and the physician and parents may elicit input from the child and weigh it appropriately in the decision-making process, although the law may not treat such input as legally informative. Ethicists and legal theorists also state that it is questionable for parents to make a decision for the child that precludes the child from making a different decision for himself later. Such a question can be raised for the decision by the parents either to circumcise or not to circumcise the child. [9]

Generally, circumcision on a minor is not ethically controversial or legally questionable when there is a clear and pressing medical indication for which it is the accepted best practice to resolve. Where circumcision is the chosen intervention, the physician has an ethical responsibility to ensure the procedure is performed competently and safely to minimize potential harms. [8] [9] Worldwide, most legal jurisdictions do not have specific laws concerning the circumcision of males, [4] but infant circumcision is not illegal in many countries. [133] A few countries have passed legislation on the procedure: Germany allows non-therapeutic circumcision, [134] while non-religious routine circumcision is illegal in South Africa and Sweden. [4] [133]

Throughout society, circumcision is often considered for reasons other than medical need. Public health advocates of circumcision consider it to have a net benefit, and therefore feel that increasing the circumcision rate is an ethical imperative. They recommend performing the procedure during the neonatal period when it is less expensive and has a lower risk of complications. [8] While studies show there is a modest epidemiological benefit to circumcision, critics argue that the number of circumcisions that would have to be performed would yield an overall negative public health outcome due to the resulting number of complications or other negative effects (such as pain). Pinto (2012) writes "sober proponents and detractors of circumcision agree that there is no overwhelming medical evidence to support either side." [8] This type of cost-benefit analysis is highly dependent on the kinds and frequencies of health problems in the population under discussion and how circumcision affects those health problems. [9]

Parents are assumed to have the child's best interests in mind. Ethically, it is imperative that the medical practitioner inform the parents about the benefits and risks of the procedure and obtain informed consent before performing it. Practically, however, many parents come to a decision about circumcising the child before he is born, and a discussion of the benefits and risks of the procedure with a physician has not been shown to have a significant effect on the decision. Some parents request to have their newborn or older child circumcised for non-therapeutic reasons, such as the parents' desires to adhere to family tradition, cultural norms or religious beliefs. In considering such a request, the physician may consider (in addition to any potential medical benefits and harms) such non-medical factors in determining the child's best interests and may ethically perform the procedure. Equally, without a clear medical benefit relative to the potential harms, a physician may take the ethical position that non-medical factors do not contribute enough as benefits to outweigh the potential harms and refuse to perform the procedure. Medical organizations such as the British Medical Association state that their member physicians are not obliged to perform the procedure in such situations. [8] [9]

In 2012 the International NGO Council on Violence against Children identified non-therapeutic circumcision of infants and boys as being among harmful practices that constitute violence against children and violate their rights. [135] The German Academy for Pediatric and Adolescent Medicine (Deutsche Akademie für Kinder- und Jugendmedizin e.V., DAKJ) recommend against routine non-medical infant circumcision. [136] The Royal Dutch Medical Association questions why the ethics regarding male genital alterations should be viewed any differently from female genital alterations. [28]

Economic considerations

The cost-effectiveness of circumcision has been studied to determine whether a policy of circumcising all newborns or a policy of promoting and providing inexpensive or free access to circumcision for all adult men who choose it would result in lower overall societal healthcare costs. As HIV/AIDS is an incurable disease that is expensive to manage, significant effort has been spent studying the cost-effectiveness of circumcision to reduce its spread in parts of Africa that have a relatively high infection rate and low circumcision prevalence. [137] Several analyses have concluded that circumcision programs for adult men in Africa are cost-effective and in some cases are cost-saving. [39] [138] In Rwanda, circumcision has been found to be cost-effective across a wide range of age groups from newborn to adult, [48] [139] with the greatest savings achieved when the procedure is performed in the newborn period due to the lower cost per procedure and greater timeframe for HIV infection protection. [12] [139] Circumcision for the prevention of HIV transmission in adults has also been found to be cost-effective in South Africa, Kenya, and Uganda, with cost savings estimated in the billions of US dollars over 20 years. [137] Hankins et al. (2011) estimated that a $1.5 billion investment in circumcision for adults in 13 high-priority African countries would yield $16.5 billion in savings. [140]

The overall cost-effectiveness of neonatal circumcision has also been studied in the United States, which has a different cost setting from Africa in areas such as public health infrastructure, availability of medications, and medical technology and the willingness to use it. [141] A study by the CDC suggests that newborn circumcision would be societally cost-effective in the United States based on circumcision's efficacy against the transmission of HIV alone during coitus, without considering any other cost benefits. [3] The American Academy of Pediatrics (2012) recommends that neonatal circumcision in the United States be covered by third-party payers such as Medicaid and insurance. [3] A 2014 review that considered reported benefits of circumcision such as reduced risks from HIV, HPV, and HSV-2 stated that circumcision is cost-effective in both the United States and Africa and may result in health care savings. [142] However, a 2014 literature review found that there are significant gaps in the current literature on male and female sexual health that need to be addressed for the literature to be applicable to North American populations. [82]


Infection and Spread of Alphaherpesviruses in the Nervous System

This chapter considers two aspects of alpha-herpesvirus pathogenesis: the invasion and spread of two representative viruses, herpes simplex virus (HSV) and pseudorabies virus (PRV) in the nervous system of animals. Three main topics are selected for analysis. First, the cell biology of viral infection and egress are considered, and the implications to the mechanisms by which HSV and PRV spread in the nervous system. Second, the molecular genetics of neurovirulence as revealed by studies of HSV is considered. Finally, the chapter reviews how the neurotropism and virulence of HSV and PRV have been exploited to analyze neuroanatomical pathways in the brain of living animals. This demonstrates the remarkable specificity of these two viruses to infect and spread in a variety of neural circuits. Both HSV and PRV spread from neuron to neuron at sites of synaptic contact. One can only speculate as to how this might happen.

Corresponding Author: 314 Schultz Laboratory, Department of Molecular Biology, Princeton University, Princeton, NJ 08544, TEL: (609) 258–2415


Watch the video: Virology Lectures 2018 #5: Attachment and Entry (January 2023).